Gene putatively regulated by attenuation in C_tetani_E88

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:117 nt.    Distance to gene:84 nt.     Distance to run of Ts=3 nt.   Size=18 nt.     Delta G= -6.70 kcal/mol
Antiterminator:    Distance from promoter:75 nt. Size=47 nt.     Delta G= -5.50 kcal/mol
Anti-antiterminator:    Distance from promoter:36 nt.    Size=49 nt.     Delta G=-12.80 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGTGT-TAAATT. It has a score value of 68.27 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGTGTATTGACGGAATCATGTGTAAATTGAGGCCTACATTTTTGACATTGATATTTT
TGATTAGCCTGCTTGTCAAATCCAAACTTATATAGTTTGTCACTATGGCAGCGAGGAC
ACTTAATTTTAGTTTTGTTCATtgttcttctctccttttctagggggataattgtttttagtcaaacttattgtatttccttat
gggaagaagagcaatgttcatattaacttaatagaacggactttaatattgggggaaatatATG

    CTC00390


Gene: CTC00390     GI: 28210145     BI number: CTC00390     GOG: -------     Description: hypothetical protei


  T
A  A
T  T        T
 TA       G  T
 CG       A  T
 AT       T  T
 AT       T  G
 AT       T  T
 CG       T  T
|  T      A  C
|  C      A  A
C  A      T  T
T  C      T  t
A  T       Cg
A  A       At
 AT       C  |
 CG        At
 TG        Gc
 GC        Gt        tc
T  |       At       t  t
 TA        Gc        ta
 CG       C  t       tg
 GC        Gc        cg
|  G       At        cg
 TA       C  |       tg
 CG        Gc        cg
 CG        Gc        ta
                        taattgtttttagtcaaacttattgtatttccttatgggaagaagagcaatgttcatattaacttaatagaacggactttaatattgggggaaatatATG


    ..................................................................................................................