                                                                        Gene putatively regulated by attenuation in C_tetani_E88

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:51 nt.    Distance to gene:79 nt.     Distance to run of Ts=0 nt.   Size=28 nt.     Delta G=-17.80 kcal/mol
Antiterminator:    Distance from promoter:50 nt. Size=17 nt.     Delta G= -3.60 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGATA-TAAAAT. It has a score value of 83 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGATAAAAAAGCACCTTATGATAAAATAGTTACCACAAAATTTGCAGAAGAAGCTAT
AAAAAATATTAAATAAtaaaaaatcctcccagggtttcttggggggatttattttgaaaagttttacttttacatattgtatatagta
aaattagatgtataattatttgaaaaagaaaggggaatttaaagATG

    CTC00408 Gene: CTC00408     GI: 28210161     BI number: CTC00408     GOG: COG1979     Description: NADH-dependent butanol dehydrogenase            tt           g  t            gc            gt            at   c        cg c  c       cg t  a       cg cg        tg cg        cg tg        cg at        ta at        at at        at             tattttgaaaagttttacttttacatattgtatatagtaaaattagatgtataattatttgaaaaagaaaggggaatttaaagATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [C] COG1979 Uncharacterized oxidoreductases, Fe-dependent alcohol dehydrogenase family ... can be seen here     ..................................................................................................................