                                                                        Gene putatively regulated by attenuation in C_tetani_E88

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:75 nt.     Distance to run of Ts=0 nt.   Size=39 nt.     Delta G=-17.60 kcal/mol
Antiterminator: Size=48 nt.     Delta G= -9.60 kcal/mol
Anti-antiterminator:   Size=51 nt.     Delta G= -6.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AGAGCAATAACTCATTTTAGCATAGAAACAGTTGGACATTTTGATTTAGATGCAGAGT
TAAAGATATGGATTTCAGGTAGTTCCACACCAGTAGAAAAACAATTTAATAAAAGTTT
AAATATATATGAATTGCAAAGTGTACTAGCTGAATATGTATTAGGATAAatctaacctgatcaa
aaataggctatctaaaataatattgtttagatagcctattttttattaagtttttactacattttagtataattatataattttgatagacaataatatg
taagtaacaaaaaaggggaaATG

    CTC00415 --- CTC00416 Gene: CTC00415     GI: 28210168     BI number: CTC00415     GOG: COG2323     Description: conserved membrane-associated protein Gene: CTC00416     GI: 28210169     BI number: CTC00416     GOG: NOG42528     Description: conserved protei GT T  A GC        at AT       A  c A  A       At A  |       Ta CG       A  a GC        Gc         t T  T       Gc       a  a T  G       At       a  t A  A       Tg       t  t A  |       Ta       a  g G  |       At        at TA       T  |       at AT        Gc        at TA        Ta        ta AT       |  a       cg TG       A  a       ta AT       T  a       at TA       A  a       ta AT       A  t       cg AT       G  a       gc A  A       Tg        gc T  G       Cg        at TG        Gc        ta TA        At        at GT        Ta        at                         ttttattaagtttttactacattttagtataattatataattttgatagacaataatatgtaagtaacaaaaaaggggaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG2323 Predicted membrane protein ... can be seen here     ..................................................................................................................