                                                                        Gene putatively regulated by attenuation in C_tetani_E88

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:121 nt.    Distance to gene:91 nt.     Distance to run of Ts=0 nt.   Size=33 nt.     Delta G=-12.30 kcal/mol
Antiterminator:    Distance from promoter:89 nt. Size=69 nt.     Delta G= -4.10 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTAAAA-TAAAAT. It has a score value of 62.25 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTAAAAACCATAGAAGAAGCGGATAAAATATTGGTTATAAAAAATGGTGAGATTATAG
AAAGAGGAAGTCATGAAACTCTAATGCAAGACCAAGGATTTTATCATAATTTGTATGT
TTCACAGTTTAAAATTTAAaaatatatgaaataagaaaacagcttaatataaattaagactgttttcttatttttttcttataaaa
tagataagaatatttacagtacatataatgtaacctattattataaatgtgtattatataacaagggggtgcatgtATG

    CTC00427 Gene: CTC00427     GI: 28210180     BI number: CTC00427     GOG: COG0584,COG4781     Description: glycerophosphoryl diester phosphodiesteras   a a  a ga ac aa tg a  c a  t a  t ga ta at ta at ta aa a a A        ta A       a  a T         ta T        at T        at A         ta A        ta A        cg A        |  a T         gc T         at T         cg G         at A         at C        at A        at C        gc             ttatttttttcttataaaatagataagaatatttacagtacatataatgtaacctattattataaatgtgtattatataacaagggggtgcatgtATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [C] COG0584 Glycerophosphoryl diester phosphodiesterase ... can be seen here [C] COG4781 Membrane domain of membrane-anchored glycerophosphoryl diester phosphodiesterase ... can be seen here     ..................................................................................................................