                                                                        Gene putatively regulated by attenuation in C_tetani_E88

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:137 nt.    Distance to gene:0 nt.     Distance to run of Ts=0 nt.   Size=23 nt.     Delta G= -7.20 kcal/mol
Antiterminator:    Distance from promoter:104 nt. Size=37 nt.     Delta G= -4.50 kcal/mol
Anti-antiterminator:    Distance from promoter:82 nt.    Size=38 nt.     Delta G= -4.20 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGATT-TATATT. It has a score value of 80.99 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGATTTTATAATAATATCTTTTTCTATATTCTTATTTGTAAAACTTATAAATTCTTT
TAAGAAAAAAGAAGAAGAGAAGCCTAAAGTAGAAGAACCATCTAAGGAAGAAAAATTA
CTTGCTGAAATAAGAGATATTTTAAAAGAAAGTAAATAAattaaaagcttttagaaactattttaaatagt
ttctttttttATG

    CTC00430 Gene: CTC00430     GI: 28210183     BI number: CTC00430     GOG: COG0716     Description: flavodoxi AT G  A        A AT       T  A GT       A  a AT        At AT        At TA        Ta A  A      G  a A  A      A  a        t A  |      A  a      t  a G  |      A  g       ta TA        Gc        ta CG        At        at G  A       At        ta TA        At        cg TA        At        at CG        Ta        at AT        Tg        at TA        Ta        gc TA        Ta        at                         ttttttATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [C] COG0716 Flavodoxins ... can be seen here     ..................................................................................................................