Gene putatively regulated by attenuation in C_tetani_E88

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:69 nt.    Distance to gene:139 nt.     Distance to run of Ts=3 nt.   Size=33 nt.     Delta G= -8.80 kcal/mol
Antiterminator:    Distance from promoter:70 nt. Size=15 nt.     Delta G= -3.30 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgtct-tacctt. It has a score value of 60.24 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgtctaagacattgaacttttgtaccttgtattaaacctaaatccaacattcttcttctagaaattccatcagatataagtttcataacagaaacaatg
ctaccaataggagctttattcaagggtagtaaagtatttttcataaaaaaacctccataaaaatttttttaactaactacgacaaactaaaatttagcct
cgtgaaaacttttatatatatttctaatatattataaatttataaatttggttacacatatatataaaatatagattaaaaaTTG

    CTC00452


Gene: CTC00452     GI: 28210205     BI number: CTC00452     GOG: COG1321     Description: iron-dependent transcriptional represso


           tt
          c  t
          g  a
           at
           gt
           gc
          a  a
          t  a
          a  g
 at       a  |
a  a       cg
 cg        cg
 cg        at
a  |       ta
 ta        cg
 cg        gt
 gc        ta
            aagtatttttcataaaaaaacctccataaaaatttttttaactaactacgacaaactaaaatttagcctcgtgaaaacttttatatatatttctaatatattataaatttataaatttggttacacatatatataaaatatagattaaaaaTTG
                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[K] COG1321 Mn-dependent transcriptional regulator ... can be seen here

    ..................................................................................................................