                                                                        Gene putatively regulated by attenuation in C_tetani_E88

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:91 nt.    Distance to gene:131 nt.     Distance to run of Ts=0 nt.   Size=27 nt.     Delta G=-11.00 kcal/mol
Antiterminator:    Distance from promoter:65 nt. Size=36 nt.     Delta G= -3.64 kcal/mol
Anti-antiterminator:    Distance from promoter:50 nt.    Size=27 nt.     Delta G= -7.20 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TAGAAT-TAGAAT. It has a score value of 61.58 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TAGAATTACAAAAAGATAATTCTAGAATAGTATTAACTCAATCGGTAGCAGACAACAA
TATTAATACGGCAGTGAGTATAGACAAATAGtttactatttgggctaaaaataagaaaaaaggttgaatagatttaa
tttattcaacctttttaattaaatattattataaaatttaattaaataatgttgtaagtacttattatgtaatgtataatttatgttaacttccaaattt
ctattgtcgatggaacgccttatgcgatgaaagtcgcacgtagggtGTG

    CTC00468 Gene: CTC00468     GI: 28210217     BI number: CTC00468     GOG: COG5279     Description: predicted transglutaminase/proteas            aa           t  g           a  a           a  a tt       a  a        t t  a      a  a      t  a Gc       a  a       ta At        ta        at Ta        cg        gt At       g  g       at At        gt        ta At        gt        at Cg        tg        at |  g       ta        gc A  g       ta        ta Gc        at        ta At        ta        gc Ta        cg        gc                         tttttaattaaatattattataaaatttaattaaataatgttgtaagtacttattatgtaatgtataatttatgttaacttccaaatttctattgtcgatggaacgccttatgcgatgaaagtcgcacgtagggtGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [D] COG5279 Uncharacterized protein involved in cytokinesis, contains TGc (transglutaminase/protease-like) domain ... can be seen here     ..................................................................................................................