                                                                        Gene putatively regulated by attenuation in C_tetani_E88

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:101 nt.    Distance to gene:34 nt.     Distance to run of Ts=0 nt.   Size=28 nt.     Delta G=-18.10 kcal/mol
Antiterminator:    Distance from promoter:68 nt. Size=39 nt.     Delta G= -6.20 kcal/mol
Anti-antiterminator:    Distance from promoter:56 nt.    Size=31 nt.     Delta G= -5.46 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgata-taatat. It has a score value of 74.97 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgataaaatcatgaaattaaagtaatatgtatatacaatagtttaataccatataaatataatattttaagaggaaattttgaactatatacttatttg
ggcactttgtatatagggagttagtagtgcaaccgaccttgattaatcagggtcggtttttatttttaaataaagcaagaaataactaggagggggtata
TTG

    CTC00471 Gene: CTC00471     GI: 28210220     BI number: CTC00471     GOG: COG4932     Description: putative S-layer protein (peptidoglycan anchored             g           a  g           t  g           a  a            tg   g        at g  g      t  t t  c      g  a       ta t  a      t  g      t  a t  c      t  t       at a  t       ta        gc t  t       cg        ta t  t       at        tg cg        cg        cg at        gc        cg ta       |  a       at at       |  a       gc ta        gc        cg at        gc        cg ta        tg        at cg        ta        at                         tttatttttaaataaagcaagaaataactaggagggggtataTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [M] COG4932 Predicted outer membrane protein ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in C_tetani_E88                                                                         Characteristics of the secondary structures Terminator:    Distance from promoter:104 nt.    Distance to gene:41 nt.     Distance to run of Ts=0 nt.   Size=22 nt.     Delta G=-12.20 kcal/mol Antiterminator:    Distance from promoter:67 nt. Size=39 nt.     Delta G= -6.20 kcal/mol                                                                         Nomenclature/Definitions The most likely promoter is: ttgata-taatat. It has a score value of 74.97 and is shown in blue Bases shared by the antitermination and termination structures are shown in red The sequences of the antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case ttgataaaatcatgaaattaaagtaatatgtatatacaatagtttaataccatataaatataatattttaagaggaaattttgaactatatacttatttg ggcactttgtatatagggagttagtagtgcaaccgaccttgattaatcagggtcggtttttatttttaaataaagcaagaaataactaggagggggtata TTG     CTC00471 Gene: CTC00471     GI: 28210220     BI number: CTC00471     GOG: COG4932     Description: putative S-layer protein (peptidoglycan anchored   a t  g a  g t  g aa tg g  t t  t t  a t  g ct        ta aa       t  a cg        at gt        gc gg        ta |  c       tg |  a       cg ga        cg tc        at tc        gc tg        cg             gtttttatttttaaataaagcaagaaataactaggagggggtataTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [M] COG4932 Predicted outer membrane protein ... can be seen here     ..................................................................................................................