                                                                        Gene putatively regulated by attenuation in C_tetani_E88

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:40 nt.     Distance to run of Ts=0 nt.   Size=30 nt.     Delta G=-13.60 kcal/mol
Antiterminator: Size=31 nt.     Delta G= -4.90 kcal/mol
Anti-antiterminator:   Size=50 nt.     Delta G= -5.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGGTAGATGTGGCAAAAGCAAATTTAGCTCATTCAAAAATGAAATACGAAGAAACAAA
ATATAGATCTGATCAAGGATTAGAAGATAAAGTCCAATTAGAGTCAGCTAAATTAGAC
TTCGAGAAAAAGAAAATAGAAGAAGAAAAAGCAATAAATGAATATATGATTACTGTAC
AGAGCTTTAAAGATACTTTAGGTATAGAAGAATAAttatataagttttgaagtaaagaggttatgtatagcctc
tttattatttttatgggaaatgatatacttattagcataatttacttatacaTTG

    CTC00489 Gene: CTC00489     GI: 28210237     BI number: CTC00489     GOG: -------     Description: conserved membrane-associated protei   T G  A G  T A  A TG TA TA CG A  A TA AT G  A        g A  A      a  t       gt At       a  a      t  a At       g  a       at Ta        ta        ta |  t       tg        tg |  a       ta        gc |  t       tg        gc Ta       g  g       at Ta        at        gc Cg        at        at Gt        ta        at At        at        at Gt        tg        ta At        at        gt Cg        ta        at                         atttttatgggaaatgatatacttattagcataatttacttatacaTTG     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in C_tetani_E88                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:48 nt.     Distance to run of Ts=0 nt.   Size=18 nt.     Delta G= -6.90 kcal/mol Antiterminator: Size=31 nt.     Delta G= -4.90 kcal/mol Anti-antiterminator:   Size=33 nt.     Delta G= -3.60 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case CGGTAGATGTGGCAAAAGCAAATTTAGCTCATTCAAAAATGAAATACGAAGAAACAAA ATATAGATCTGATCAAGGATTAGAAGATAAAGTCCAATTAGAGTCAGCTAAATTAGAC TTCGAGAAAAAGAAAATAGAAGAAGAAAAAGCAATAAATGAATATATGATTACTGTAC AGAGCTTTAAAGATACTTTAGGTATAGAAGAATAAttatataagttttgaagtaaagaggttatgtatagcctc tttattatttttatgggaaatgatatacttattagcataatttacttatacaTTG     CTC00489 Gene: CTC00489     GI: 28210237     BI number: CTC00489     GOG: -------     Description: conserved membrane-associated protei   A A  A T  G        T T  A      A  A T  T      A  A C  A      G  t GC        At AT        Aa GT        Gt |  T       Aa        gt |  A      T  t      t  a A  G       Aa        at CG        Ta        ta AT        Gg        tg TA        Gt        gc GT        At        gc TA        Tt        at CG        Tt        gc                         tttattatttttatgggaaatgatatacttattagcataatttacttatacaTTG     ..................................................................................................................