                                                                        Gene putatively regulated by attenuation in C_tetani_E88

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:110 nt.    Distance to gene:80 nt.     Distance to run of Ts=0 nt.   Size=23 nt.     Delta G=-11.30 kcal/mol
Antiterminator:    Distance from promoter:74 nt. Size=45 nt.     Delta G= -4.60 kcal/mol
Anti-antiterminator:    Distance from promoter:44 nt.    Size=47 nt.     Delta G= -6.80 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TAGACA-GAGAAT. It has a score value of 60.24 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TAGACAATGTAGGTCTAGAAATAAAAGAGAATAATGAAAAACAGAAGGTTTATGTAGG
CTATGTAAAAAAAGATTATAGTTATAGTAAAGTTTTACAAAAAGTAAAAGTTGAGAAG
ATAATTAAAAAATAAgtttaaaatatctcctagctaaaaaagttaggagtatttttaaatacactgtaattaattacataagtaatata
taatatatatgttggaattatttatttacataaaggaggactatttATG

    CTC00491 Gene: CTC00491     GI: 28210238     BI number: CTC00491     GOG: COG2247     Description: putative S-layer protein/N-acetylmuramoyl-L-alanine amidas   A A  A        T A  A      A  A CG       A  A AT       A  g TA        At TA        At TA        At TA        Ta G  G       Ta AT       |  a AT       A  a |  G       At |  A       Ta         a A  G       At       a  a T  A       Gc       a  a G  A      A  |       ta A  G       At        cg TA        Gc        gt AT       A  c       at TA        Gt        ta TA        Ta        cg GT        Tg        cg AT        Gc        ta TA        At        cg                         tatttttaaatacactgtaattaattacataagtaatatataatatatatgttggaattatttatttacataaaggaggactatttATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [M] COG2247 Putative cell wall-binding domain ... can be seen here     ..................................................................................................................