                                                                        Gene putatively regulated by attenuation in C_tetani_E88

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:131 nt.     Distance to run of Ts=0 nt.   Size=27 nt.     Delta G=-13.40 kcal/mol
Antiterminator: Size=70 nt.     Delta G= -7.75 kcal/mol
Anti-antiterminator:   Size=43 nt.     Delta G= -3.83 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TGGAGTAAATCTAAATTAGTTTCAATAGTTATAAGTATATTAATGATTTGTGTATATA
TTTTATTTTCAAAGATTGGAATAGTATGTAAGTAAaataaaaagtcggaatattctaaagtgttaggatatatc
aaataaagtccagtgaagttgtttcattggactttatttgatatatagaattataattgataataggagtattaaggaaatggagggatttaaattataa
tcttaaaatattgttataatgtaatagattaagagattatggactaaatcataaaggagtggttccaaTTG

    CTC00515 Gene: CTC00515     GI: 28210257     BI number: CTC00515     GOG: COG2247     Description: cwp66 homolog/N-acetylmuramoyl-L-alanine amidas            gt           a  g            at            at            ta            cg            tg            ta            at            ta            at           |  a            at            gc           g  a           c  a           t  |           g  |           a  |           a  |           a  |           a  |           a  |   a       t  | a  t      a  | A  a      a  | A  a      A  | T  a      A  | G  a      T  | A  a      G  | A  g      A  | T  t      A  |        t Gc       T  |      t  g Tg       G  |       gt A  g       Ta        at T  a       At        at G  a       Ta        gc At       G  a       ta Ta       A  a       gt At       T  g       at At       A  |       cg Gc        At        cg Gt        Gc        ta Ta        Gc        gc Ta        Ta        at                         ttatttgatatatagaattataattgataataggagtattaaggaaatggagggatttaaattataatcttaaaatattgttataatgtaatagattaagagattatggactaaatcataaaggagtggttccaaTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [M] COG2247 Putative cell wall-binding domain ... can be seen here     ..................................................................................................................