                                                                        Gene putatively regulated by attenuation in C_tetani_E88

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:85 nt.     Distance to run of Ts=0 nt.   Size=31 nt.     Delta G=-12.30 kcal/mol
Antiterminator: Size=46 nt.     Delta G= -4.00 kcal/mol
Anti-antiterminator:   Size=53 nt.     Delta G= -6.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AGGGTATGTTATACATCAAAATAGAGGTTTTCCAGATAGGCCTTTGATAAGGGTTTTA
TATGACAGTGACACAAGGGAGCCAGTCCAATTTTATGAAATAGATTTATTAAAACACA
AAAATCTAGTAATCAAAACTATAGTTTAAttactatagattaaagtgaatatattgaaatttaagacagctgtaattta
ttaattagtagctgtctttgttaataagtttttatatacttataataaattcaaatataaatgttataataggtatataaaaatattcatataaggaggt
atttaATG

    CTC00530 Gene: CTC00530     GI: 28210270     BI number: CTC00530     GOG: COG0705     Description: conserved membrane protein (rhomboid family AA T  t T  t Ta Gc At Ta        aa At       g  a Ta       t  t Cg       t  t |  a       at |  t       ta |  t      a  a |  a      t  g       at A  a      a  a      t  t A  a      a  c       ta A  g      g  a       ta At        tg        at Cg        gc        at Ta        at        ta A  a      a  g      |  g At        at        gt Ta        ta        ta Gt        ta        cg |  a       at        gc A  t       gt        at T  t       at        cg Cg        ta        at Ta        at        gc                         tttgttaataagtttttatatacttataataaattcaaatataaatgttataataggtatataaaaatattcatataaggaggtatttaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG0705 Uncharacterized membrane protein (homolog of Drosophila rhomboid) ... can be seen here     ..................................................................................................................