                                                                        Gene putatively regulated by attenuation in C_tetani_E88

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:85 nt.     Distance to run of Ts=0 nt.   Size=36 nt.     Delta G=-19.40 kcal/mol
Antiterminator: Size=42 nt.     Delta G= -5.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TATAAGTGGAAATATGGATAAATACAATAAAAAAACCATAGAAGAAAATTATAAAAAA
GGAAAAAAACTTTTAGAACAATATAAAAAGGCTAAAGGCAATGAAAAATTGGAAATAC
CAGAGCTTAAATTGTTTTACTAAaatacaaggaaaactgtgaatatatgataatatatagatgtagtattgtttatagaaaca
atactacatcttttttatattgataaaagtctttatttaaatatggtttggtcgatatagactattagtgaattagttttaagatttgaggtggatattt
tATG

    CTC00544 Gene: CTC00544     GI: 28210283     BI number: CTC00544     GOG: -------     Description: conserved protei ta a  g ta at tg        ta at       a  g a  a       ta tg        ta at        ta g  a       gc t  t       ta a  |       ta t  |       at at        ta tg        gc at        at at        ta gt        gc ta        ta gt        at ta        gc cg        at             tttttatattgataaaagtctttatttaaatatggtttggtcgatatagactattagtgaattagttttaagatttgaggtggatattttATG     ..................................................................................................................