Gene putatively regulated by attenuation in C_tetani_E88

This operon is putativelly rgulated by Lysine_riboswitch

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:77 nt.    Distance to gene:75 nt.     Distance to run of Ts=0 nt.   Size=32 nt.     Delta G=-15.30 kcal/mol
Antiterminator:    Distance from promoter:63 nt. Size=19 nt.     Delta G= -3.50 kcal/mol
Anti-antiterminator:    Distance from promoter:15 nt.    Size=53 nt.     Delta G= -3.90 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgata-taaaat. It has a score value of 68.94 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgatactgtatgactggtcttatttaaaatatgaataagattgtcacaaaatgaatttgtggagagctatcattcaatggaaaacacctttaaagtgta
gaaacatcacactccttgattgacgaagctcaaggagtgttttttgttggatggactcttctcctcaaaagatattcactaaaattaattataaaaatat
ttaaggaggagaaagaaaattATG

    CTC00567


Gene: CTC00567     GI: 28210303     BI number: CTC00567     GOG: COG1757     Description: Na+/H+ antiporte


 tt
a  c
c  a
 ta
 at
 tg
 cg
g  a
a  a
g  a
a  a
g  |                  c
 gc                 a  g
 ta                 g  a
 gc                  ta
t  c                 tg
t  |                |  c
t  |                 at
 at        ac        gc
 at       a  a       ta
 gt        at        ta
 ta        gc        cg
a  a      a  |       cg
a  a       ta        ta
a  g       gc        cg
 at        ta        at
 cg        gc        cg
 at        at        at
                        tttttgttggatggactcttctcctcaaaagatattcactaaaattaattataaaaatatttaaggaggagaaagaaaattATG
                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[C] COG1757 Na+/H+ antiporter ... can be seen here

                                                                        Genes that have a predicted attenuator with a riboswitch:

Lysine_riboswitch sequence ... can be seen here
    ..................................................................................................................