                                                                        Gene putatively regulated by attenuation in C_tetani_E88

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:77 nt.    Distance to gene:84 nt.     Distance to run of Ts=0 nt.   Size=29 nt.     Delta G=-12.20 kcal/mol
Antiterminator:    Distance from promoter:22 nt. Size=69 nt.     Delta G= -3.75 kcal/mol
Anti-antiterminator:    Distance from promoter:10 nt.    Size=20 nt.     Delta G= -3.80 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTTAAG-TAAAAG. It has a score value of 64.93 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTTAAGGAAAGTAAAAATTATTTTAAAAGATCTCTAGGTGGTCTTATGAAAAAAGGAC
TTATAGAACAAACAAAAGAAGGAACTAAACTTATACAAAAATAAggaaaagataggtgttttaaaaa
catctatctttttttgaaaaattaataataaattaagaataaaattgttaaaattaatgtagaaaaggctataattatagtagacaaggagtgataatAT
G

    CTC00653 Gene: CTC00653     GI: 28210380     BI number: CTC00653     GOG: COG2928     Description: putative transporte            AA           C  A           A  A            TA            AT            TA            TA            Cg           |  g           A  a           A  a           A  a            Ta            Cg           A  |           A  |           G  |           G  |           A  |           A  |           G  |           A  |           A  |           A  |           A  |           C  |           A  |           A  |           A  |           C  |           A  |        a           A  |      t  a           G  |       ta           A  |       ta            Ta        ta AA        At        gc G  A       Ta        ta T  A       Tg        gt A  A       Cg        gc TA        At        at TG       G  g       ta CG        Gt        at TA        At        gc GC        At        at GT        At        at                         tttttgaaaaattaataataaattaagaataaaattgttaaaattaatgtagaaaaggctataattatagtagacaaggagtgataatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG2928 Uncharacterized conserved protein ... can be seen here     ..................................................................................................................