                                                                        Gene putatively regulated by attenuation in C_tetani_E88

This operon is putativelly rgulated by Riboflavin_riboswitch

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:191 nt.    Distance to gene:7 nt.     Distance to run of Ts=0 nt.   Size=28 nt.     Delta G=-16.80 kcal/mol
Antiterminator:    Distance from promoter:157 nt. Size=47 nt.     Delta G= -4.20 kcal/mol
Anti-antiterminator:    Distance from promoter:129 nt.    Size=52 nt.     Delta G= -7.70 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: tttata-tgagat. It has a score value of 62.25 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

tttatacatccttcagggtttggtgagattccataccggtggtaaagcccacgagccgcaaggcagatctggtgaaattccagggccgacagttaaagtc
tggatgaaagaaggaaattacatatacattctaatcagtatacacttgtatagttttatacttatgtagctaatttaagttatattatttattttagaat
gtattaggtaagaatactttaccctgaaagaattaattctttcagggttttttagcgacATG

    CTC00671 --- CTC00672 Gene: CTC00671     GI: 28210395     BI number: CTC00671     GOG: COG0117,COG1985     Description: riboflavin biosynthesis protein Gene: CTC00672     GI: 28210396     BI number: CTC00672     GOG: COG0307     Description: riboflavin synthase alpha chai             t           a  a ta       a  c a  t       gt t  t       at ta        at gt        ta at        gc at        gc ta       a  | t  t      t  | t  t      t  | at       a  | at       t  | ta       g  | cg       t  |       ta |  a      a  |      t  a |  a      a  |       at g  t       gc        at a  g       at        gc t  t       tg        at g  a       ta        at t  t       ta        at at        ta        gc ta       a  |       ta tg        tg        cg cg        ta        cg at        ta        cg ta        at        at                         tttttagcgacATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [H] COG0117 Pyrimidine deaminase ... can be seen here [H] COG1985 Pyrimidine reductase, riboflavin biosynthesis ... can be seen here [H] COG0307 Riboflavin synthase alpha chain ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Riboflavin_riboswitch sequence ... can be seen here     ..................................................................................................................