                                                                        Gene putatively regulated by attenuation in C_tetani_E88

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:188 nt.    Distance to gene:13 nt.     Distance to run of Ts=0 nt.   Size=32 nt.     Delta G=-12.90 kcal/mol
Antiterminator:    Distance from promoter:164 nt. Size=36 nt.     Delta G= -5.10 kcal/mol
Anti-antiterminator:    Distance from promoter:139 nt.    Size=31 nt.     Delta G= -4.40 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttaagt-tataat. It has a score value of 71.62 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttaagtatattggtaatcgcctttataatggtaaatagaaattatataaatagtatagaggggttaggacggttcattttaatatgtagtgtagtgattt
tttctataaatagtcttagactttataaaaatgtattatttttaagagataacaaactgttataaaatccacatgttataaaaaaatagatcatggtggt
tctttccgtaatggaataatactaatacaatatatattgtattagtatttttttaggaggatttttATG

    CTC00683 --- CTC00684 Gene: CTC00683     GI: 28210407     BI number: CTC00683     GOG: COG1181     Description: D-alanine--D-alanine ligase Gene: CTC00684     GI: 28210408     BI number: CTC00684     GOG: COG1167     Description: transcriptional regulatory protei             a           t  a           g  t            cg aa        cg        ta a  a       ta       a  t a  a       ta        ta at       |  t       at ta       t  a       at a  g      c  a       cg t  a      t  t       at t  t       ta        ta gc        gc        at ta        gt        at at        ta        ta |  g      |  a       cg cg       |  t       at at       g  a       ta cg        gc        at cg        ta        at                         tttttaggaggatttttATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [M] COG1181 D-alanine-D-alanine ligase and related ATP-grasp enzymes ... can be seen here [KE] COG1167 Transcriptional regulators containing a DNA-binding HTH domain and an aminotransferase domain (MocR family) and their eukaryotic orthologs ... can be seen here     ..................................................................................................................