                                                                        Gene putatively regulated by attenuation in C_tetani_E88

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:99 nt.    Distance to gene:24 nt.     Distance to run of Ts=1 nt.   Size=24 nt.     Delta G= -8.10 kcal/mol
Antiterminator:    Distance from promoter:50 nt. Size=61 nt.     Delta G= -5.16 kcal/mol
Anti-antiterminator:    Distance from promoter:17 nt.    Size=59 nt.     Delta G= -7.20 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTTAAA-TAGAAT. It has a score value of 72.29 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTTAAAGAGGAGTTAGGTCTAGTAGAATTTTCAAATACAATACTGTTAGATGGAAAAG
ACACTATGGAATTTAATTATAGATTAAATAAATAGtctttgtttaatgaacaactaacaatgaagaatgatttt
ctgattttaatcagaaaatctctttttttttattctttttagtatagaatataattaaagcattGTG

    CTC00686 Gene: CTC00686     GI: 28210410     BI number: CTC00686     GOG: COG3857     Description: ATP-dependent nuclease subunit TT         c A  A      a  a AT       a  a TA       g  c TG       t  t TA       a  a AT       a  a AT       t  c G  A       ta G  A       ta TA       g  t AT       t  g TA        ta |  A       ta |  A       cg C  T       ta A  A      |  a CG       G  t At       A  g Gc        Ta At        At        tt At        At       t  a At        At        ta A  |      T  t       at G  |      A  c       gc G  |      A  |       ta Tg        At        cg At        Tg        ta Gt        Ta        ta At        At        ta Ta        Gt        ta Ta        At        at                         ctctttttttttattctttttagtatagaatataattaaagcattGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [L] COG3857 ATP-dependent nuclease, subunit B ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in C_tetani_E88                                                                         Characteristics of the secondary structures Terminator:    Distance from promoter:92 nt.    Distance to gene:32 nt.     Distance to run of Ts=0 nt.   Size=36 nt.     Delta G=-12.60 kcal/mol Antiterminator:    Distance from promoter:63 nt. Size=61 nt.     Delta G= -5.16 kcal/mol Anti-antiterminator:    Distance from promoter:15 nt.    Size=74 nt.     Delta G=-11.40 kcal/mol                                                                         Nomenclature/Definitions The most likely promoter is: TTTAAA-TAGAAT. It has a score value of 72.29 and is shown in blue Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case TTTAAAGAGGAGTTAGGTCTAGTAGAATTTTCAAATACAATACTGTTAGATGGAAAAG ACACTATGGAATTTAATTATAGATTAAATAAATAGtctttgtttaatgaacaactaacaatgaagaatgatttt ctgattttaatcagaaaatctctttttttttattctttttagtatagaatataattaaagcattGTG     CTC00686 Gene: CTC00686     GI: 28210410     BI number: CTC00686     GOG: COG3857     Description: ATP-dependent nuclease subunit   T A  A TG TA AT AT TA TA TA AT         a A  A      a  g G  A      g  a G  |      t  a TA       a  t AT       a  g TA       c  a CG       a  t At        at |  c       tt |  t      c  t |  t      a  c |  t       at Cg        cg        tt At        aa       t  a Gt        at        ta At       |  t       at |  a      g  t       gc |  a      t  t       ta A  t       aa        cg A  g       a        ta A  a       t        ta G  a       t        ta Gc       t         ta Ta       g         at A  a      t  |       gc Gc        t       t  | At        t       a  | Ta        c        at Ta        t        gc Gc        G        at Ta        A        at                         tttttttattctttttagtatagaatataattaaagcattGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [L] COG3857 ATP-dependent nuclease, subunit B ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in C_tetani_E88                                                                         Characteristics of the secondary structures Terminator:    Distance from promoter:98 nt.    Distance to gene:39 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G=-11.00 kcal/mol Antiterminator:    Distance from promoter:63 nt. Size=61 nt.     Delta G= -5.16 kcal/mol Anti-antiterminator:    Distance from promoter:30 nt.    Size=74 nt.     Delta G=-11.40 kcal/mol                                                                         Nomenclature/Definitions The most likely promoter is: TTTAAA-TAGAAT. It has a score value of 72.29 and is shown in blue Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case TTTAAAGAGGAGTTAGGTCTAGTAGAATTTTCAAATACAATACTGTTAGATGGAAAAG ACACTATGGAATTTAATTATAGATTAAATAAATAGtctttgtttaatgaacaactaacaatgaagaatgatttt ctgattttaatcagaaaatctctttttttttattctttttagtatagaatataattaaagcattGTG     CTC00686 Gene: CTC00686     GI: 28210410     BI number: CTC00686     GOG: COG3857     Description: ATP-dependent nuclease subunit   G A  t Tc At At At Tg At At At         a T  a      a  g T  a      g  a A  |      t  a Gt       a  t Ag       a  g Ta       c  a Aa       a  t Tc        at |  a       tt |  a      c  t |  c      a  c |  t       at Ta        cg Aa        aa Ac        at Ta       |  t |  a      g  t |        t  t T         aa        tt T         a       t  a A         t        ta A         t        at G       t         gc G       g         ta T        t  |       cg A        t        ta T        t        ta C        c        ta A        t        ta C        G        at A        A        gc                         tctttttttttattctttttagtatagaatataattaaagcattGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [L] COG3857 ATP-dependent nuclease, subunit B ... can be seen here     ..................................................................................................................