                                                                        Gene putatively regulated by attenuation in C_tetani_E88

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:81 nt.    Distance to gene:83 nt.     Distance to run of Ts=1 nt.   Size=36 nt.     Delta G=-14.10 kcal/mol
Antiterminator:    Distance from promoter:31 nt. Size=60 nt.     Delta G=-11.50 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ATGAAA-TATAAT. It has a score value of 67.6 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ATGAAAGATAAGGACATTGTTTATATAATAGAAGTAAGACCTCGGGAAAATGCTGTTA
AATCCTTCAAAGTATTAAAAACTTTATATCCTTAAatataaagttaaaaaagctgtgccggaatgatttttaaa
tcgttttgacacagcttcttttatttcttttaagataattatataatgtgacatagcaaattaaaatactttatgttaaattatacatgaagtatgaata
cttttaTTG

    CTC00692 Gene: CTC00692     GI: 28210415     BI number: CTC00692     GOG: COG0210     Description: DNA helicase I TT C  A C  A Ta At Ta At Ta Ta Ta Cg At At        tt A  a      t  a A  a       ta A  a       ta T  a       at T  a       gc A  a       tg Tg        at Gc        at At        gt A  g       gt At        cg Cg       c  a T  c       gc T  c       ta Cg        gc Cg        ta Ta        cg             cttcttttatttcttttaagataattatataatgtgacatagcaaattaaaatactttatgttaaattatacatgaagtatgaatacttttaTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [L] COG0210 Superfamily I DNA and RNA helicases ... can be seen here     ..................................................................................................................