                                                                        Gene putatively regulated by attenuation in C_tetani_E88

This operon is putativelly rgulated by Aminoacyl-tRNA-synthetase_T-box

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:36 nt.     Distance to run of Ts=0 nt.   Size=24 nt.     Delta G=-13.90 kcal/mol
Antiterminator: Size=41 nt.     Delta G= -6.30 kcal/mol
Anti-antiterminator:   Size=50 nt.     Delta G=-10.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case
The T-box sequence: aaggtggtaccacg is shown in italic-bold style

caaatatcttataataggagacaatttaaaaagcactgaaaggtaatagtaaacaaatctttatttaagagagtcgatggtaggtgtaaatcgataataa
agattgttgaatccgacctagagctgcataggggtaacaacctatgccggattaattccgttataattttaaagtctactcttttatttagagtagtaaa
ttaaggtggtaccacgtgattattgtaaatcccgtccttagcttttaagctaagggcttttttattagaaaaaattattataaaaggaggattttttaat
ATG

    CTC00695 --- CTC00694 --- CTC00693 Gene: CTC00695     GI: 28210418     BI number: CTC00695     GOG: COG0075     Description: serine--pyruvate/aspartate aminotransferase Gene: CTC00694     GI: 28210417     BI number: CTC00694     GOG: COG0111     Description: D-3-phosphoglycerate dehydrogenase Gene: CTC00693     GI: 28210416     BI number: CTC00693     GOG: COG1082     Description: conserved protein, endonuclease-lik   a t  t t  t t  t ta         t cg       a  t ta       g  a cg       t  t at        gt ta        cg cg        at |  t      |  a t  a      c  a g  a      c  a a  a      a  t       tt at       t  c      t  a at        gc        ta ta        gc        cg ta        tg        gc tg       |  t       at tg        gc        ta at        gc        ta a  g       at        cg tg        at        cg at        ta        tg ta        tg        gc                         ttttttattagaaaaaattattataaaaggaggattttttaatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG0075 Serine-pyruvate aminotransferase/archaeal aspartate aminotransferase ... can be seen here [HE] COG0111 Phosphoglycerate dehydrogenase and related dehydrogenases ... can be seen here [G] COG1082 Sugar phosphate isomerases/epimerases ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Aminoacyl-tRNA-synthetase_T-box sequence ... can be seen here     ..................................................................................................................