                                                                        Gene putatively regulated by attenuation in C_tetani_E88

This operon is putativelly rgulated by Cobalamin_riboswitch

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:114 nt.     Distance to run of Ts=1 nt.   Size=22 nt.     Delta G=-16.10 kcal/mol
Antiterminator: Size=43 nt.     Delta G= -9.50 kcal/mol
Anti-antiterminator:   Size=35 nt.     Delta G=-11.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

accactctttcaaaaagggaaggggaagggaaagacaagggtgaatcatgagccaggagacctgcctgtatatgaaagataaactttcggcgggaaagtc
tttagtaaatacgtaaaaaatccggtctttaggccggttttatttataatgtttataaagcaggctgaaaggcctgcttgttttattaaaagctgtgttc
ttctaaaagatctaaagaatgaattgtcaacctcctagaagacaaccttctatcaaactcaagaacacagctaatttttttactaaagattaatagagag
GTG

    cbiP --- cbiB --- cobD --- cbiM Gene: cbiP     GI: 28210441     BI number: CTC00720     GOG: COG1492     Description: cobyric acid synthase cbiP Gene: cbiB     GI: 28210442     BI number: CTC00721     GOG: COG1270     Description: cobalamin biosynthesis protein cbiB Gene: cobD     GI: 28210443     BI number: CTC00722     GOG: COG0079     Description: aminotransferase cobD Gene: cbiM     GI: 28210444     BI number: CTC00723     GOG: COG0310     Description: cobalt transport protein cbi             a           a  t           t  g           a  t tt       t  t t  a      t  t cg        ta tg        at gc        ta gc        ta cg        ta cg        tg        aa t  t       gc       g  a at       g  a       tg at        cg        cg at        cg        gc |  a       gc        gc at        gt        at at       a  g       cg at        ta        gc ta        ta        at gt        ta        at                         gttttattaaaagctgtgttcttctaaaagatctaaagaatgaattgtcaacctcctagaagacaaccttctatcaaactcaagaacacagctaatttttttactaaagattaatagagagGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [H] COG1492 Cobyric acid synthase ... can be seen here [H] COG1270 Cobalamin biosynthesis protein CobD/CbiB ... can be seen here [E] COG0079 Histidinol-phosphate/aromatic aminotransferase and cobyric acid decarboxylase ... can be seen here [P] COG0310 ABC-type Co2+ transport system, permease component ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Cobalamin_riboswitch sequence ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in C_tetani_E88 This operon is putativelly rgulated by Cobalamin_riboswitch                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:157 nt.     Distance to run of Ts=0 nt.   Size=16 nt.     Delta G= -9.10 kcal/mol Antiterminator: Size=39 nt.     Delta G= -5.03 kcal/mol Anti-antiterminator:   Size=48 nt.     Delta G=-15.40 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case accactctttcaaaaagggaaggggaagggaaagacaagggtgaatcatgagccaggagacctgcctgtatatgaaagataaactttcggcgggaaagtc tttagtaaatacgtaaaaaatccggtctttaggccggttttatttataatgtttataaagcaggctgaaaggcctgcttgttttattaaaagctgtgttc ttctaaaagatctaaagaatgaattgtcaacctcctagaagacaaccttctatcaaactcaagaacacagctaatttttttactaaagattaatagagag GTG     cbiP --- cbiB --- cobD --- cbiM Gene: cbiP     GI: 28210441     BI number: CTC00720     GOG: COG1492     Description: cobyric acid synthase cbiP Gene: cbiB     GI: 28210442     BI number: CTC00721     GOG: COG1270     Description: cobalamin biosynthesis protein cbiB Gene: cobD     GI: 28210443     BI number: CTC00722     GOG: COG0079     Description: aminotransferase cobD Gene: cbiM     GI: 28210444     BI number: CTC00723     GOG: COG0310     Description: cobalt transport protein cbi   a t  a a  a gc at at at        aa gc       a  t tg        ta a  |       gc t  |      a  g a  |      t  t tg       t  a gc       t  a tg       c  a cg       t  a cg       g  a g  a      a  a t  a      a  |       tt c  a       at       t  a cg        gc        cg at        gc        tg gc       g  g       gc at        cg        gc gt        gt        cg gt        gc        cg                         ttttatttataatgtttataaagcaggctgaaaggcctgcttgttttattaaaagctgtgttcttctaaaagatctaaagaatgaattgtcaacctcctagaagacaaccttctatcaaactcaagaacacagctaatttttttactaaagattaatagagagGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [H] COG1492 Cobyric acid synthase ... can be seen here [H] COG1270 Cobalamin biosynthesis protein CobD/CbiB ... can be seen here [E] COG0079 Histidinol-phosphate/aromatic aminotransferase and cobyric acid decarboxylase ... can be seen here [P] COG0310 ABC-type Co2+ transport system, permease component ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Cobalamin_riboswitch sequence ... can be seen here     ..................................................................................................................