                                                                        Gene putatively regulated by attenuation in C_tetani_E88

This operon is putativelly rgulated by Cobalamin_riboswitch

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:23 nt.     Distance to run of Ts=0 nt.   Size=32 nt.     Delta G=-15.40 kcal/mol
Antiterminator: Size=47 nt.     Delta G=-14.90 kcal/mol
Anti-antiterminator:   Size=38 nt.     Delta G= -7.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TGAAAACTAAtaattaaaatagaataatatgaataaaaaaggtgaaatagttatttcttaaaagggaagcatggtgaaaatccatcacggtcc
cgccactgtaatcagggagttaggttttaccactgttaattaacgggaaggagaatctataaaaactatgaactgtaagtcaggagacctgccttttttt
aattaaacattcctacgaggatgggagatgtgatagttttatgaagctaaaaacatcttttcctaggaaaagatgttttttttgttaatttaaaaggggg
agttaatTTG

    CTC00745 --- CTC00746 Gene: CTC00745     GI: 28210465     BI number: CTC00745     GOG: -------     Description: ferredoxin-like protein Gene: CTC00746     GI: 28210466     BI number: CTC00746     GOG: COG2109     Description: cob(I)alamin adenosyltransferas            at           t  g            ta            ta            tg ag        gc g  g       at c  a       ta at       |  a tg       a  a       ta cg       g  a      c  g cg        ta        cg ta        gc        ta |  g       ta        ta ta        at        ta at        gc        ta cg        at        cg at        gt        ta |  g       gt        at a  a      g  |       cg at       t  |       at ta        at        at tg        gc        at at        gc        at at        at        at                         tttgttaatttaaaagggggagttaatTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [H] COG2109 ATP:corrinoid adenosyltransferase ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Cobalamin_riboswitch sequence ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in C_tetani_E88 This operon is putativelly rgulated by Cobalamin_riboswitch                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:30 nt.     Distance to run of Ts=0 nt.   Size=18 nt.     Delta G= -6.40 kcal/mol Antiterminator: Size=47 nt.     Delta G=-14.90 kcal/mol Anti-antiterminator:   Size=38 nt.     Delta G= -7.20 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case TGAAAACTAAtaattaaaatagaataatatgaataaaaaaggtgaaatagttatttcttaaaagggaagcatggtgaaaatccatcacggtcc cgccactgtaatcagggagttaggttttaccactgttaattaacgggaaggagaatctataaaaactatgaactgtaagtcaggagacctgccttttttt aattaaacattcctacgaggatgggagatgtgatagttttatgaagctaaaaacatcttttcctaggaaaagatgttttttttgttaatttaaaaggggg agttaatTTG     CTC00745 --- CTC00746 Gene: CTC00745     GI: 28210465     BI number: CTC00745     GOG: -------     Description: ferredoxin-like protein Gene: CTC00746     GI: 28210466     BI number: CTC00746     GOG: COG2109     Description: cob(I)alamin adenosyltransferas            ta           t  t            tg            ta            ga ag        ag g  g       tc c  a       at at       |  a tg       g  a cg       t  a cg        ga ta        ta |  g       ac ta        ga at        at cg        gc        ta at        gt       c  g |  g       gt        cg a  a      t  |       ta at       a  |       ta ta        gt        ta tg        gt        ta at        ac        cg at        gc        ta                         tgttttttttgttaatttaaaagggggagttaatTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [H] COG2109 ATP:corrinoid adenosyltransferase ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Cobalamin_riboswitch sequence ... can be seen here     ..................................................................................................................