                                                                        Gene putatively regulated by attenuation in C_tetani_E88

This operon is putativelly rgulated by Cobalamin_riboswitch

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:135 nt.    Distance to gene:40 nt.     Distance to run of Ts=0 nt.   Size=28 nt.     Delta G=-13.40 kcal/mol
Antiterminator:    Distance from promoter:102 nt. Size=40 nt.     Delta G= -4.30 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ctgtaa-taaaat. It has a score value of 62.92 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ctgtaatgctgacgaaatcttataaaatccactagatatattttatctgggaaggttagaaattaggaagaagctaagccaggaaacctgcctaataagt
gttaattctttcggagggggagatataaacttttttaatatgtaaatgttttatgttatatataaaaagaacttccatggaagttcttttttattttata
gaaaaaaagatatagtataaatttaagaaaggatgtcATG

    CTC00747 Gene: CTC00747     GI: 28210467     BI number: CTC00747     GOG: COG5492     Description: putative surface/cell-adhesion protein, multiple big2 domai tt t  t g  a t  t a  g at at        at ta       c  g gt        cg ta        ta at        ta ta        cg at        at a  a       at ta        gc ta        at ta        at ta        at tg        at ta        at             tattttatagaaaaaaagatatagtataaatttaagaaaggatgtcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [N] COG5492 Bacterial surface proteins containing Ig-like domains ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Cobalamin_riboswitch sequence ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in C_tetani_E88 This operon is putativelly rgulated by Cobalamin_riboswitch                                                                         Characteristics of the secondary structures Terminator:    Distance from promoter:140 nt.    Distance to gene:47 nt.     Distance to run of Ts=0 nt.   Size=18 nt.     Delta G= -8.20 kcal/mol Antiterminator:    Distance from promoter:84 nt. Size=64 nt.     Delta G= -8.02 kcal/mol Anti-antiterminator:    Distance from promoter:68 nt.    Size=36 nt.     Delta G= -5.80 kcal/mol                                                                         Nomenclature/Definitions The most likely promoter is: ctgtaa-taaaat. It has a score value of 62.92 and is shown in blue Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case ctgtaatgctgacgaaatcttataaaatccactagatatattttatctgggaaggttagaaattaggaagaagctaagccaggaaacctgcctaataagt gttaattctttcggagggggagatataaacttttttaatatgtaaatgttttatgttatatataaaaagaacttccatggaagttcttttttattttata gaaaaaaagatatagtataaatttaagaaaggatgtcATG     CTC00747 Gene: CTC00747     GI: 28210467     BI number: CTC00747     GOG: COG5492     Description: putative surface/cell-adhesion protein, multiple big2 domai            ta           g  a            ta            at            tg            at            at           t  t           t  t           t  a           t  t           t  |           t  |            cg            at            at   a       |  a g  g       at g  g       ta cg        at tg        ta tg        at ta       |  a cg       |  a ta       |  a t  t      g  a a  a      a  a       at a  t      g  g      c  g t  a      g  a       cg t  a      g  a       ta g  |       gc        ta ta        gt        cg gc        at        at at        gc        at at        gc        gc                         ttttttattttatagaaaaaaagatatagtataaatttaagaaaggatgtcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [N] COG5492 Bacterial surface proteins containing Ig-like domains ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Cobalamin_riboswitch sequence ... can be seen here     ..................................................................................................................