                                                                        Gene putatively regulated by attenuation in C_tetani_E88

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:97 nt.    Distance to gene:76 nt.     Distance to run of Ts=0 nt.   Size=33 nt.     Delta G=-17.90 kcal/mol
Antiterminator:    Distance from promoter:43 nt. Size=69 nt.     Delta G= -6.15 kcal/mol
Anti-antiterminator:    Distance from promoter:32 nt.    Size=44 nt.     Delta G= -6.89 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTCAAA-TAAAAG. It has a score value of 61.58 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTCAAAAAGAAGGAGAATATACTGTAAAAGCTTTTGTTTGGGATAGTTTAGATAAAAT
GAATTCTATTTCAAAGGTTATAGAAATTCCTGTAAAATAGcttgtagataataaattctaaaattaaagg
catacctattaactattagttaataggtatgttgttttgataataaatttataatataatctaaagtagagaattatgtgattatataaaaatagaaagg
cgattttaagagATG

    CTC00751 --- cbiO --- CTC00753 --- CTC00754 Gene: CTC00751     GI: 28210471     BI number: CTC00751     GOG: COG0619     Description: cobalt transport protein Gene: cbiO     GI: 28210472     BI number: CTC00752     GOG: COG1122     Description: cobalt transport ATP-binding protein cbiO Gene: CTC00753     GI: 28210473     BI number: CTC00753     GOG: COG1122     Description: cobalt transport ATP-binding protein Gene: CTC00754     GI: 28210474     BI number: CTC00754     GOG: NOG39199     Description: conserved membrane protei            ta           a  a           a  a           t  t            at            gc            at            ta           g  a           t  a           t  a           c  t           G  t           A  a           T  a           A  | AT       A  | A  T      A  | A  C      A  | GC       T  | AT       G  | TG        Ta         t AT        Cg       a  t TA        Cg       t  a TA       T  c       cg G  A       Ta        at G  A       At        at A  T      A  a       ta A  A      A  c       ta A  G       Gc        at C  c       At        ta T  t       Ta        cg T  t      |  t       cg Tg        At        at At        Ta        ta Ta        Ta        at Cg        Gc        cg Ta        Gt        gt                         tgttttgataataaatttataatataatctaaagtagagaattatgtgattatataaaaatagaaaggcgattttaagagATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [P] COG0619 ABC-type cobalt transport system, permease component CbiQ and related transporters ... can be seen here [P] COG1122 ABC-type cobalt transport system, ATPase component ... can be seen here [P] COG1122 ABC-type cobalt transport system, ATPase component ... can be seen here     ..................................................................................................................