                                                                        Gene putatively regulated by attenuation in C_tetani_E88

This operon is putativelly rgulated by Aminoacyl-tRNA-synthetase_T-box

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:76 nt.     Distance to run of Ts=0 nt.   Size=32 nt.     Delta G=-20.30 kcal/mol
Antiterminator: Size=36 nt.     Delta G= -8.11 kcal/mol
Anti-antiterminator:   Size=10 nt.     Delta G= -1.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case
The T-box sequence: agggtggtaccgcg is shown in italic-bold style

gcgagtcgatgatggtgaaagattgatatgaattttatactgaagaacatccctgagtctctaaccgaaatcaatatattgagagtaggcttagacgaaa
ccagatcgttaaagctgggagtattgttagatacttttaaagaggagagccttttataggctaaccagggtggtaccgcgagagtttaagcttttcgtcc
cttagttgggatgaaaggcttttttgattaaaaaaatttatttactaaaatccatgagggtaagtagtttattataggaaataatttaggaggtaatttt
ATG

    CTC00781 Gene: CTC00781     GI: 28210498     BI number: CTC00781     GOG: COG2502     Description: aspartate--ammonia ligas            ta           t  a            tg            gc           |  t            at            gt        ag            at       t  t            gc       t  t            cg        cg            gt        cg           c  |       cg           c  |       ta           a  |       gt           t  |       cg           g  |       ta           g  |       ta ta       t  |       ta g  c       gc        tg gc        gc        cg tg        gc        gc gc        at        at                         tttttgattaaaaaaatttatttactaaaatccatgagggtaagtagtttattataggaaataatttaggaggtaattttATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG2502 Asparagine synthetase A ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Aminoacyl-tRNA-synthetase_T-box sequence ... can be seen here     ..................................................................................................................