                                                                        Gene putatively regulated by attenuation in C_tetani_E88

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:139 nt.    Distance to gene:72 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G=-13.10 kcal/mol
Antiterminator:    Distance from promoter:113 nt. Size=37 nt.     Delta G= -4.40 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTTTAG-TACAAT. It has a score value of 60.24 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTTTAGAGAAAAAACTACCATATACAATAGGTGGTGGAATAGGTCAATCTAGAATGTG
TATGCTTTTCCTAAAAAAAGCTCATATAGGAGAGGTTCAATCCTCAATATGGCCAGAA
GAAATGATAAAGTTTTGTGAAGAAAAAGGAATGACAATATTATAAtatgaaagtctctctttaataa
aagagggactttttatcgtatagaaaggttttttaatatacatactataaatatattgtggatttagtaaaatattattttaaaagGTG

    CTC00782 Gene: CTC00782     GI: 28210499     BI number: CTC00782     GOG: NOG12883     Description: conserved protei AT T  A TA At Ta At |  g |  a       at |  a      a  a A  a       ta Cg        ta At        ta Gc        cg T  t       ta A  c       cg At        tg Gc        cg Gt        ta At        gc At        at             ttttatcgtatagaaaggttttttaatatacatactataaatatattgtggatttagtaaaatattattttaaaagGTG     ..................................................................................................................