                                                                        Gene putatively regulated by attenuation in C_tetani_E88

This operon is putativelly rgulated by Aminoacyl-tRNA-synthetase_T-box

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:155 nt.    Distance to gene:36 nt.     Distance to run of Ts=0 nt.   Size=30 nt.     Delta G=-23.00 kcal/mol
Antiterminator:    Distance from promoter:124 nt. Size=44 nt.     Delta G= -6.50 kcal/mol
Anti-antiterminator:    Distance from promoter:92 nt.    Size=41 nt.     Delta G= -5.20 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ctgaaa-taggct. It has a score value of 63.59 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case
The T-box sequence: tgggtggtaccgcg is shown in italic-bold style

ctgaaaaaaatttaaatttttagtaggctgagccggatacctaacgttaataagggtataaagaggatttgtgtcaatcaaattgggtggtaccgcgaat
aataatcgtcccttgtagggggcgtttttttattaggtattttttattcaattgggttatgcaaatcaactagggtggtaacacggagcatcgtcccttt
agggatgatgctcttttttaattcaaatataaaaataaaaaagggggatttattTTG

    CTC00787 Gene: CTC00787     GI: 28210504     BI number: CTC00787     GOG: COG1114     Description: branched-chain amino acid transport system carrier protei            ta           g  a            gc            ta            gc           g  g   t       g  | t  t      a  | t  t      t  | at       c  | ta       a  | gt       a  | g  t       cg        tt a  c       ta       t  a ta       a  |       cg ta       a  |       cg at       a  |       cg t  t       cg        ta t  g       gc        gt tg        ta        cg tg        at        ta t  t      |  c       at t  t      t  g       cg ta       t  t       gc gt        gc        at cg        gc        gc gc        gc        gt                         tttttaattcaaatataaaaataaaaaagggggatttattTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG1114 Branched-chain amino acid permeases ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Aminoacyl-tRNA-synthetase_T-box sequence ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in C_tetani_E88 This operon is putativelly rgulated by Aminoacyl-tRNA-synthetase_T-box                                                                         Characteristics of the secondary structures Terminator:    Distance from promoter:77 nt.    Distance to gene:108 nt.     Distance to run of Ts=0 nt.   Size=18 nt.     Delta G=-10.10 kcal/mol Antiterminator:    Distance from promoter:65 nt. Size=15 nt.     Delta G= -1.20 kcal/mol                                                                         Nomenclature/Definitions The most likely promoter is: ctgaaa-taggct. It has a score value of 63.59 and is shown in blue Bases shared by the antitermination and termination structures are shown in red The sequences of the antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case ctgaaaaaaatttaaatttttagtaggctgagccggatacctaacgttaataagggtataaagaggatttgtgtcaatcaaattgggtggtaccgcgaat aataatcgtcccttgtagggggcgtttttttattaggtattttttattcaattgggttatgcaaatcaactagggtggtaacacggagcatcgtcccttt agggatgatgctcttttttaattcaaatataaaaataaaaaagggggatttattTTG     CTC00787 Gene: CTC00787     GI: 28210504     BI number: CTC00787     GOG: COG1114     Description: branched-chain amino acid transport system carrier protei            gt   a       t  a a  t       tg t  a       cg a  a       cg at        cg gc        tg cg        gc gt        cg             tttttttattaggtattttttattcaattgggttatgcaaatcaactagggtggtaacacggagcatcgtccctttagggatgatgctcttttttaattcaaatataaaaataaaaaagggggatttattTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG1114 Branched-chain amino acid permeases ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Aminoacyl-tRNA-synthetase_T-box sequence ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in C_tetani_E88 This operon is putativelly rgulated by Aminoacyl-tRNA-synthetase_T-box                                                                         Characteristics of the secondary structures Terminator:    Distance from promoter:77 nt.    Distance to gene:122 nt.     Distance to run of Ts=0 nt.   Size=18 nt.     Delta G=-10.10 kcal/mol Antiterminator:    Distance from promoter:38 nt. Size=15 nt.     Delta G= -1.20 kcal/mol Anti-antiterminator:   Size=50 nt.     Delta G= -7.60 kcal/mol                                                                         Nomenclature/Definitions The most likely promoter is: ctgaaa-taggct. It has a score value of 63.59 and is shown in blue Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case The T-box sequence: tgggtggtaccgcg is shown in italic-bold style ctgaaaaaaatttaaatttttagtaggctgagccggatacctaacgttaataagggtataaagaggatttgtgtcaatcaaattgggtggtaccgcgaat aataatcgtcccttgtagggggcgtttttttattaggtattttttattcaattgggttatgcaaatcaactagggtggtaacacggagcatcgtcccttt agggatgatgctcttttttaattcaaatataaaaataaaaaagggggatttattTTG     CTC00787 Gene: CTC00787     GI: 28210504     BI number: CTC00787     GOG: COG1114     Description: branched-chain amino acid transport system carrier protei   t t  a g  a c  t a  a a  a tg cg cg at ta at |  a |  a |  a g  g g  a cg cg |  a                 gt gt         c       t  a at       t  a       tg gt       g  a       cg tg       t  t       cg |  t       gc        cg cg        ta        tg gt        ta        gc gc        ta        cg                         tttttttattaggtattttttattcaattgggttatgcaaatcaactagggtggtaacacggagcatcgtccctttagggatgatgctcttttttaattcaaatataaaaataaaaaagggggatttattTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG1114 Branched-chain amino acid permeases ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Aminoacyl-tRNA-synthetase_T-box sequence ... can be seen here     ..................................................................................................................