                                                                        Gene putatively regulated by attenuation in C_tetani_E88

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:146 nt.    Distance to gene:27 nt.     Distance to run of Ts=0 nt.   Size=25 nt.     Delta G=-11.80 kcal/mol
Antiterminator:    Distance from promoter:103 nt. Size=49 nt.     Delta G= -5.00 kcal/mol
Anti-antiterminator:    Distance from promoter:71 nt.    Size=38 nt.     Delta G= -7.50 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTCATA-TTTAAT. It has a score value of 60.91 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTCATATAACAAAAGAAGGTAAAGTTTTAATAAATGATAATCTAAACGGAATAGTTAA
AGATGTGGCAACAGGTAAGGAAACTAAATATAAAGGTAAATTTCTTCAAATATACGAA
GGTGGAGTTTCTTCTATAAGTGAAAATAAATTAATAAAAACTAAATTTAATTAGttataa
actcactgtaagtaatttgcagtgagtttttaactaatataataaaaattaaagaagGTG

    CTC00793 Gene: CTC00793     GI: 28210510     BI number: CTC00793     GOG: COG1994     Description: protein with metal dependent protease domai            TA           C  A           A  A            AT            AT   A        AT G  G      A  A G  T       TA T  T       AT GT        AT GC        TA AT        TG AT        At         a GC        At       t  a C  |      |  a       gt AT       A  t       at TA       T  a       at AT       A  a       tg TA       A  a       gc A  A      A  c       ta A  G       At        cg AT        Gc        at CG        Ta        cg TA        Gc        ta TA        At        cg                         tttttaactaatataataaaaattaaagaagGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG1994 Zn-dependent proteases ... can be seen here     ..................................................................................................................