Gene putatively regulated by attenuation in C_tetani_E88
Characteristics of the secondary structures
Terminator: Distance from promoter:98 nt. Distance to gene:71 nt. Distance to run of Ts=0 nt. Size=37 nt. Delta G=-10.40 kcal/mol
Antiterminator: Distance from promoter:42 nt. Size=62 nt. Delta G= -3.97 kcal/mol
Anti-antiterminator: Distance from promoter:10 nt. Size=40 nt. Delta G= -5.60 kcal/mol
Nomenclature/Definitions
The most likely promoter is: TTTACA-TATAAT. It has a score value of 67.6 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator
structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case
TTTACATAAATCAGATTTTAAAGACAATATAATGACAGAATATGAAACTAAGTTTACA
TCTATGGGAATGAAAACTATGTTTTTAATAGCAAAATTAAAATAAccaataaataaagttttgaacc
ccgaaatccatattatagctaaagtgcagcttccagatatggatttttgggagtaatatcagcaaaatagatatataggcggtaaagaagcagataataa
acatttaggaggatttttATG
CTC00795
Gene: CTC00795 GI: 28210512 BI number: CTC00795 GOG: NOG45848 Description: conserved protein (pathogens
ca
c a
A t
A a
T a
A a
A t
A a
A a
Ta
Tg
T At
A G At g
T G At a t
CG At a g
TA Cg a c
| A | a ta
AT | a cg
CG G c gc
A A A c at
TA T c | t
TA A c | c
TA A g t c
GC Ta a a
AT Ta tg
A A Ta ta
T T T t at
CG T c ta
AT Gc at
AT Ta cg
AT At cg
GT Ta ta
tttttgggagtaatatcagcaaaatagatatataggcggtaaagaagcagataataaacatttaggaggatttttATG
..................................................................................................................