Gene putatively regulated by attenuation in C_tetani_E88

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:72 nt.    Distance to gene:68 nt.     Distance to run of Ts=0 nt.   Size=34 nt.     Delta G=-19.20 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ATGATA-AAAGAT. It has a score value of 62.92 and is shown in blue

ATGATACAGTTCATGAAATGTGTAAAGATGAAGCAAGACACGGTAAAGCATTTAAAGG
TTTATTAGATAGACATTTCAAATAAatagaactttatataaaacgcaaaaaacgacttatataggtcgttttttgcgtttta
tataattcaaaatactgtaagcataagatataatgtaaagtatagtatataaaaaggagaggattatATG

    CTC00827


Gene: CTC00827     GI: 28210544     BI number: CTC00827     GOG: COG0561     Description: putative haloacid dehalogenase-like hydrolas


          ta
         a  t
          ta
          tg
          cg
          at
          gc
          cg
          at
          at
          at
          at
          at
          at
          cg
          gc
          cg
            ttttatataattcaaaatactgtaagcataagatataatgtaaagtatagtatataaaaaggagaggattatATG
                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[R] COG0561 Predicted hydrolases of the HAD superfamily ... can be seen here

    ..................................................................................................................