                                                                        Gene putatively regulated by attenuation in C_tetani_E88

This operon is putativelly rgulated by Aminoacyl-tRNA-synthetase_T-box

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:107 nt.     Distance to run of Ts=0 nt.   Size=30 nt.     Delta G=-18.40 kcal/mol
Antiterminator: Size=34 nt.     Delta G= -4.60 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

tagattttaatgaatgggccttgtagaagtaaatcgaaatctttaatgtaaagagagtagtaattatcggaaacctaccgttagaaagggaaggatatgt
tagtatcctgtaaaagaggtgcattttgcacaatttaggtggtaccgcgaataataccttcgtcctagttttttaggatgaaggtttttttatttaataa
ttttaagaaagggggagcaactatgttgtgaaagctaaacattgagaatatatattgtaaatttaaaagaaaatggaatttagaaaggacgttatgtcaa
ATG

    CTC00833 Gene: CTC00833     GI: 28210550     BI number: CTC00833     GOG: NOG07243     Description: putative tryptophan transport protei ga c  a g  t c  a c  a       tt at       t  t ta        gt gc        at gc        ta |  t       cg |  t       cg |  c       ta |  g       gt t  t       cg gc        ta gc        ta at        cg ta        cg tg        at             ttttttatttaataattttaagaaagggggagcaactatgttgtgaaagctaaacattgagaatatatattgtaaatttaaaagaaaatggaatttagaaaggacgttatgtcaaATG                                                                         Genes that have a predicted attenuator with a riboswitch: Aminoacyl-tRNA-synthetase_T-box sequence ... can be seen here     ..................................................................................................................