                                                                        Gene putatively regulated by attenuation in C_tetani_E88

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:83 nt.    Distance to gene:48 nt.     Distance to run of Ts=0 nt.   Size=39 nt.     Delta G=-16.70 kcal/mol
Antiterminator:    Distance from promoter:64 nt. Size=30 nt.     Delta G= -5.00 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttggta-aaacat. It has a score value of 61.58 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttggtagatcctccaaagtttgaaaacatgttcatgcaattaaacacaatatatacacatccttttaataaaaatatttaaagtttaaattaattataga
agtttcttatgaagatactatgaagaaaaataaagtatcttcatagtatctttatttaactatggtattatttaaatataaaattaaataggagggtata
cttGTG

    CTC00872 --- CTC00873 Gene: CTC00872     GI: 28210587     BI number: CTC00872     GOG: COG0745     Description: two-component response regulator Gene: CTC00873     GI: 28210588     BI number: CTC00873     GOG: COG0642     Description: sensory transduction histidine kinas             a           t  a           a  a           a  g           a  t ta       a  a t  t       at cg        gc ta        at ta        at tg        gc g  a       ta a  t       at a  a       ta gc        cg at        at ta        ta at        at tg        gc ta        at             ttatttaactatggtattatttaaatataaaattaaataggagggtatacttGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [TK] COG0745 Response regulators consisting of a CheY-like receiver domain and a winged-helix DNA-binding domain ... can be seen here [T] COG0642 Signal transduction histidine kinase ... can be seen here     ..................................................................................................................