                                                                        Gene putatively regulated by attenuation in C_tetani_E88

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:48 nt.     Distance to run of Ts=0 nt.   Size=23 nt.     Delta G= -8.10 kcal/mol
Antiterminator: Size=62 nt.     Delta G= -4.65 kcal/mol
Anti-antiterminator:   Size=54 nt.     Delta G= -7.16 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

aatttttattaatgaacaatgattaatgaacaattgtggatattttttctccattaacattacgaaaaaattttaattgtaaatttatacattaagtggt
tcttaataagagctgcaatgtttagctaagcaaacgagcataaaaaacaaaatcgaagattttctatagcaaagcagaagaaaatccacctaaattgttc
attattgattgttagttgttcattaaaaaaactgccacgcagtttttttattttgcgaattgacaacatgggaaaagctaatatatacttataattccta
GTG

    CTC00895 Gene: CTC00895     GI: 28210606     BI number: CTC00895     GOG: COG0671     Description: phosphatas            ta           t  t            at            cg            ta           t  t   a       g  t a  a      t  g cg       t  | gc       a  | a  a       at t  g       at a  a       ta ta        cg cg       c  t ta        at ta        cg ta       |  t ta       |  t at       |  c gc       |  a |  c      c  t a  a      t  t        a a  c      a  a      c  c g  c      a  a       cg c  t      a  a       gc t  a      a  a       ta a  a      g  a       cg a  a      a  a       at at       a  a       at at        gc        at cg        at        at at        cg        at at        gc        at                         tattttgcgaattgacaacatgggaaaagctaatatatacttataattcctaGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [I] COG0671 Membrane-associated phospholipid phosphatase ... can be seen here     ..................................................................................................................