Gene putatively regulated by attenuation in C_tetani_E88

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:153 nt.     Distance to run of Ts=1 nt.   Size=30 nt.     Delta G=-10.20 kcal/mol
Antiterminator: Size=58 nt.     Delta G= -8.60 kcal/mol
Anti-antiterminator:   Size=35 nt.     Delta G= -5.60 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GTTTAGCTTGTTTACGTATGAGAAGAACGGAACCTAACATTAAAAGACCTTATAAGGT
TCCAGGAGGAAAAGTTGGAATAATACTCGCATGTATGTCTTCGCTTATTATTATAGGA
TTGTTAGTTATTCCTGGTAGTCCTGCTTCTTTAAATTTTGTTGAATGGATGGTTGTGC
TTACATGGTTTTTAATAGGATTTGCACTTATGCTAATTAGAGGTAAAAAAGTAGAAAC
TAAAGATAGTGGTGCTAACTAAagttaattataaatagttaaaaagttatagttttggggggaatttcATG

    CTC00933


Gene: CTC00933     GI: 28210644     BI number: CTC00933     GOG: COG1228     Description: parathion hydrolas


           TT
          A  A
          T  T
           TT
           CA
           GT
           CA
          T  G
          T  |
          C  |
           TG
           GA
 GC        TT
C  A      |  T
T  T      A  G
 CG        TT
 AT        GT        AT
 TA        TA       T  T
 AT        AG       T  C
A  G      C  T       GC
T  |       GT        AT
A  |       CA       T  G
 AT       T  T      T  G
 GC        C        GT
 GT        A        TA
|  T      |         TG
T  C      T         AT
 TG       A         GC
 GC        A        GC
 AT        T        AT
 AT        A        TG
                        CTTCTTTAAATTTTGTTGAATGGATGGTTGTGCTTACATGGTTTTTAATAGGATTTGCACTTATGCTAATTAGAGGTAAAAAAGTAGAAACTAAAGATAGTGGTGCTAACTAAagttaattataaatagttaaaaagttatagttttggggggaatttcATG
                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[Q] COG1228 Imidazolonepropionase and related amidohydrolases ... can be seen here

    ..................................................................................................................