                                                                        Gene putatively regulated by attenuation in C_tetani_E88

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:106 nt.    Distance to gene:66 nt.     Distance to run of Ts=0 nt.   Size=36 nt.     Delta G=-18.90 kcal/mol
Antiterminator:    Distance from promoter:46 nt. Size=64 nt.     Delta G= -4.50 kcal/mol
Anti-antiterminator:    Distance from promoter:17 nt.    Size=56 nt.     Delta G= -5.37 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TAGAAA-TATAAt. It has a score value of 64.26 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TAGAAAAAAGGTGAATAATAAAAAAGTATAAttatagaataaaatattactataaagtagaagaaaagatgaattat
gaagtgaattttgaataaatatttatagagattaaataaataagtgttaaagaaaataatagcttgatggtactatataagtatggtattatcaagctat
tttaattttattaattgtgattaattcttaaaaaggattaaattattataaaaatagggggataattATG

    CTC00936 Gene: CTC00936     GI: 28210647     BI number: CTC00936     GOG: COG1882     Description: formate acetyltransferase             a           g  t           a  t           g  a           a  a            ta            at tg        ta a  a       ta ta        ta tg        at at        ta a  g      a  a g  a      a  g ta        at at        tg gt        at at        at        aa at       |  a      t  g a  g      |  a       at a  a      g  a       ta g  a       tg        at a  t       ta        tg a  a       ta        cg g  a       ta        at a  a      |  a       ta t  t      |  t       gt g  a      |  a       gt at       a  a       ta at       a  t       at at       g  a       gc ta        tg        ta at        gc        ta ta        at        cg cg        at        gc                         tattttaattttattaattgtgattaattcttaaaaaggattaaattattataaaaatagggggataattATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [C] COG1882 Pyruvate-formate lyase ... can be seen here     ..................................................................................................................