                                                                        Gene putatively regulated by attenuation in C_tetani_E88

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:146 nt.     Distance to run of Ts=0 nt.   Size=38 nt.     Delta G=-10.50 kcal/mol
Antiterminator: Size=59 nt.     Delta G=-12.60 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GAGCAAGTAGCAACTATGGAAAATATATCTGAAAGTGCAGATACATTACATAAAACCA
TAGAAAAACTAAATAATGTGGTGGGGAAATTTAAATTTTAGcaccacaaaatagaagtctttaagtataa
atatacgattaagggcttttatttttatatatagaaataaagcagcttataatttacgaagtaagttatggtcctgatattattagaaaattataaaaat
actgaaaaatattattgaattatatggggttaaatgatatacttttattaaatcattacaaaatataacaaaGTG

    CTC00943 --- CTC00944 --- CTC00945 --- CTC00946 Gene: CTC00943     GI: 28210654     BI number: CTC00943     GOG: COG2390     Description: transcriptional regulatory protein Gene: CTC00944     GI: 28210655     BI number: CTC00944     GOG: COG0235     Description: L-fuculose phosphate aldolase Gene: CTC00945     GI: 28210656     BI number: CTC00945     GOG: COG0182     Description: putative translation initiation factor EIF-2B subunit 1 Gene: CTC00946     GI: 28210657     BI number: CTC00946     GOG: COG4857     Description: 5-methylthioribose kinas TA T  A TA AT AT AT GT G  A G  G Gc Ta Gc        aa Gc       a  t Ta        ta Gc        at Ta        ta A  a       gc A  a      |  g T  a      |  a A  |      a  t A  |       at At        ta Ta        ta Cg        tg A  a       cg A  a       tg A  g       gc A  |       at At        at Gc        gt At        at             atttttatatatagaaataaagcagcttataatttacgaagtaagttatggtcctgatattattagaaaattataaaaatactgaaaaatattattgaattatatggggttaaatgatatacttttattaaatcattacaaaatataacaaaGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [K] COG2390 Transcriptional regulator, contains sigma factor-related N-terminal domain ... can be seen here [G] COG0235 Ribulose-5-phosphate 4-epimerase and related epimerases and aldolases ... can be seen here [J] COG0182 Predicted translation initiation factor 2B subunit, eIF-2B alpha/beta/delta family ... can be seen here [R] COG4857 Predicted kinase ... can be seen here     ..................................................................................................................