                                                                        Gene putatively regulated by attenuation in C_tetani_E88

This operon is putativelly rgulated by Cobalamin_riboswitch

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:176 nt.    Distance to gene:32 nt.     Distance to run of Ts=0 nt.   Size=30 nt.     Delta G=-15.60 kcal/mol
Antiterminator:    Distance from promoter:143 nt. Size=42 nt.     Delta G= -5.10 kcal/mol
Anti-antiterminator:    Distance from promoter:105 nt.    Size=50 nt.     Delta G=-10.30 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: tttaat-gaaaat. It has a score value of 66.93 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

tttaattaaaagggaagttgggtgaaaatcccacgcggtaccgccgctgtaagagagaagttttcttctattatgccactgttttttaatgggaaggcag
aagaaaattatgatactcgagccagaatatctgcctattttattcactatagctctacgagtaatagaggagtgtttgttatagtttgtttatgtacata
tttataactcttcagctattcgtagttggagagttttttatttaaataaaaattaagaaggtgaagtggaaaaATG

    CTC00960 --- fecD_lrep_2 --- fecE --- CTC00963 Gene: CTC00960     GI: 28210669     BI number: CTC00960     GOG: COG0614     Description: putative iron(III) dicitrate-binding periplasmic protein Gene: fecD_lrep_2     GI: 28210670     BI number: CTC00784     GOG: COG0609     Description: iron(III) dicitrate transport system permease protein fecD Gene: fecE     GI: 28210671     BI number: CTC00962     GOG: COG1120     Description: putative hemin transport system ATP-binding protein fecE Gene: CTC00963     GI: 28210672     BI number: CTC00963     GOG: COG5561     Description: conserved protei   g a  t g  a c  a at ta        at cg       t  g ta       t  t cg        ta g  g       gc a  |       ta t  |      |  t a  |      t  a       tc ta       t  t      t  g cg        gt        at at        at        ta cg        ta        cg t  t       at        gt t  t       ta        at at        ta        cg tg        gc        tg t  t      |  t       ta t  t      t  c       cg ta       t  t       ta at       t  t       cg ta        gc        at cg        ta        at                         ttttatttaaataaaaattaagaaggtgaagtggaaaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [P] COG0614 ABC-type Fe3+-hydroxamate transport system, periplasmic component ... can be seen here [P] COG0609 ABC-type Fe3+-siderophore transport system, permease component ... can be seen here [PH] COG1120 ABC-type cobalamin/Fe3+-siderophores transport systems, ATPase components ... can be seen here [S] COG5561 Predicted metal-binding protein ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Cobalamin_riboswitch sequence ... can be seen here     ..................................................................................................................