                                                                        Gene putatively regulated by attenuation in C_tetani_E88

This operon is putativelly rgulated by Aminoacyl-tRNA-synthetase_T-box

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:184 nt.    Distance to gene:34 nt.     Distance to run of Ts=0 nt.   Size=34 nt.     Delta G=-17.40 kcal/mol
Antiterminator:    Distance from promoter:166 nt. Size=29 nt.     Delta G= -5.50 kcal/mol
Anti-antiterminator:    Distance from promoter:123 nt.    Size=51 nt.     Delta G= -7.59 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: tttaga-taaaat. It has a score value of 74.97 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case
The T-box sequence: agagtggtaccgcg is shown in italic-bold style

tttagattaatttataatataataaaattctaggaagaggaaagtaactttttctttctttttaagcgagcagggtatggtgggagcctgtaaaagagga
ataagtaaaatagagccttagagaagtttatctgaactaatagtaggataaaccgctaaaaagcgttaaatttttaagaggacttatgtcaattagagtggtaccgcggataaaaccgtctctttataatgttaaagagatggtttttttatatgaaaaataataaatacaggagggttataaaATG

    CTC00966 Gene: CTC00966     GI: 28210674     BI number: CTC00966     GOG: COG0018     Description: arginyl-tRNA synthetas ta t  t cg at gc g  a a  a g  | at at ta tg t  | t  | t  | a  | a  | a  |                 at t  |                a  g t  |       gg       t  t g  |      c  a       at c  |      g  t       ta g  |      c  a       ta a  |      c  a       ta a  |      a  a       cg a  |       ta        ta a  |       gc        cg a  |       gc        ta ta        tg        gt cg       |  t       cg gt        gc        cg cg        at        at cg        gc        at at        at        at                         ttttatatgaaaaataataaatacaggagggttataaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [J] COG0018 Arginyl-tRNA synthetase ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Aminoacyl-tRNA-synthetase_T-box sequence ... can be seen here     ..................................................................................................................