                                                                        Gene putatively regulated by attenuation in C_tetani_E88

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:38 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G= -6.50 kcal/mol
Antiterminator: Size=56 nt.     Delta G=-11.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AAAGGGAGCTAGTATAGGGCTTAAAGATTTGGAAAAAGAATTTAATATTGAAAGACAG
AGTGAAGTTATAAGTGGTCAAAATTTGGCAAAAACCTTTGGTAAGGTTATGAAGGATA
GGGACTATATAGATAGAATGCCATCAGATAAAAAAAATAGAATTCTTCTTTATAATGA
GCAGGATGTAGTGAGTCTTTTCTATATTATTACTAATTGGTTTAGAGTAATAAAGGAA
AAATAGaggctaagaaacctttatttttctttggaaaataatatattaacatagaaaggaagaaaaaaATG

    CTC00971 Gene: CTC00971     GI: 28210679     BI number: CTC00971     GOG: COG2186     Description: transcriptional regulator, putative pyruvate dehydrogenase complex represso   G T  G T  T AT AT TA CG A  | TA TG AT TA TA AT TA A  A TA CG TG TA        ag |  A      a  a |  A      t  a |  A      c  a |  A       gc |  T       gc |  A       at TG        Gt Ta        At Cg        Ta Tg        At Gc        At At        At             ttctttggaaaataatatattaacatagaaaggaagaaaaaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [K] COG2186 Transcriptional regulators ... can be seen here     ..................................................................................................................