                                                                        Gene putatively regulated by attenuation in C_tetani_E88

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:101 nt.    Distance to gene:62 nt.     Distance to run of Ts=1 nt.   Size=30 nt.     Delta G=-16.30 kcal/mol
Antiterminator:    Distance from promoter:39 nt. Size=73 nt.     Delta G= -9.90 kcal/mol
Anti-antiterminator:   Size=70 nt.     Delta G= -9.46 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TAGAGA-TAAAAT. It has a score value of 66.93 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TAGAGAATAGAGAAGAAAAATATAGTAAAATTGCTTCAATAGTATTAAAGGAAGCTCA
AAAAACTACTGCAGGATTTCTTTTAGATTATTATGAGAATGTAAAAAATGAAGAGAGT
TTTTTAAATTTGAGTAAATAAaatcctccaattggaggattttattattttataaagaatctaactatatataagcaaggcttcc
taaactattcgctattcactaaatataagGTG

    CTC00991 --- CTC00992 Gene: CTC00991     GI: 28210697     BI number: CTC00991     GOG: NOG13988     Description: conserved protein Gene: CTC00992     GI: 28210698     BI number: CTC00992     GOG: COG1032     Description: magnesium-protoporphyrin IX monomethyl ester oxidative cyclas             G           A  A           A  G   T       G  A C  A       TG A  C       AT A  T       AT A  G       AT A  C       AT A  A       AT A  G       AT CG        TA TA       G  A C  |       TA GT        AT AT        AT AT        GT GC       A  G GT       G  A AT        TG AT        AT AT        TA TA       T  | TG       A  | |  A      T  | |  T      T  | AT       A  |       at TA       G  |      a  t GT       A  |       cg AT       T  |       cg TA        TA        ta AT        TA        cg |  G      T  T       cg A  A      C  A       ta CG        TA        at TA        Ta        at TA        Ta        At |  T       At        At CG        Gc        Ta GT        Gc        At TA        At        At                         attttataaagaatctaactatatataagcaaggcttcctaaactattcgctattcactaaatataagGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [C] COG1032 Fe-S oxidoreductase ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in C_tetani_E88                                                                         Characteristics of the secondary structures Terminator:    Distance from promoter:107 nt.    Distance to gene:70 nt.     Distance to run of Ts=0 nt.   Size=18 nt.     Delta G=-10.30 kcal/mol Antiterminator:    Distance from promoter:68 nt. Size=73 nt.     Delta G= -9.90 kcal/mol Anti-antiterminator:    Distance from promoter:57 nt.    Size=45 nt.     Delta G= -6.10 kcal/mol                                                                         Nomenclature/Definitions The most likely promoter is: TAGAGA-TAAAAT. It has a score value of 66.93 and is shown in blue Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case TAGAGAATAGAGAAGAAAAATATAGTAAAATTGCTTCAATAGTATTAAAGGAAGCTCA AAAAACTACTGCAGGATTTCTTTTAGATTATTATGAGAATGTAAAAAATGAAGAGAGT TTTTTAAATTTGAGTAAATAAaatcctccaattggaggattttattattttataaagaatctaactatatataagcaaggcttcc taaactattcgctattcactaaatataagGTG     CTC00991 --- CTC00992 Gene: CTC00991     GI: 28210697     BI number: CTC00991     GOG: NOG13988     Description: conserved protein Gene: CTC00992     GI: 28210698     BI number: CTC00992     GOG: COG1032     Description: magnesium-protoporphyrin IX monomethyl ester oxidative cyclas             t           a  c           a  c           A  t            Ac            Tc            Aa            Aa            At            Tt            G            A           G            T            T            T            A           A   G       A A  A       T A  G       T G  A       T TG       T  | AT       T  | AT       T  | AT       G  | AT       A  | AT       G  | AT       A  | TA       G  | G  A       A TA        A AT       G         at AT       T        a  t GT        A        cg A  G       A        cg G  A       A        ta TG        A        cg AT        A        cg TA        A        ta TA        T        at                         tttattattttataaagaatctaactatatataagcaaggcttcctaaactattcgctattcactaaatataagGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [C] COG1032 Fe-S oxidoreductase ... can be seen here     ..................................................................................................................