                                                                        Gene putatively regulated by attenuation in C_tetani_E88

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:118 nt.    Distance to gene:63 nt.     Distance to run of Ts=0 nt.   Size=34 nt.     Delta G= -9.10 kcal/mol
Antiterminator:    Distance from promoter:59 nt. Size=70 nt.     Delta G= -6.20 kcal/mol
Anti-antiterminator:    Distance from promoter:20 nt.    Size=61 nt.     Delta G=-16.60 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGGTA-TTTAGT. It has a score value of 66.93 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGGTATGGAACTGGGAGCTGGATTTAGTGTTTTACTTTCATGTTTACCTATTGCATT
TGTTGGATGGAAATCAGCTTTAGCACAGGCTAAAACAGCAGCATCTGCAGTATCTATT
CTTGCAAAAAGACCTGAACACAAtactaaaggtatagttttaacagttatggttgaaacatatgctcttttaggtttcgttat
gtcagtattaatgttaagataatatccctaaaaaattaaaattaagggaGTG

    CTC00996 --- CTC00997 --- CTC00998 --- CTC00999 --- CTC01000 --- CTC01001 Gene: CTC00996     GI: 28210702     BI number: CTC00996     GOG: COG1390     Description: V-type sodium ATP synthase subunit E Gene: CTC00997     GI: 28210703     BI number: CTC00997     GOG: COG1527     Description: V-type sodium ATP synthase subunit C Gene: CTC00998     GI: 28210704     BI number: CTC00998     GOG: COG1436     Description: V-type sodium ATP synthase subunit G Gene: CTC00999     GI: 28210705     BI number: CTC00999     GOG: COG1155     Description: V-type sodium ATP synthase subunit A Gene: CTC01000     GI: 28210706     BI number: CTC01000     GOG: COG1156     Description: V-type sodium ATP synthase subunit B Gene: CTC01001     GI: 28210707     BI number: CTC01001     GOG: COG1394     Description: V-type sodium ATP synthase subunit             A           C  A           G  A            TA            TA            CG            TA           T  C GC       A  C A  A      T  T T  C       CG TA        TA TG       |  A CG       |  C GC       |  A AT       |  C C  A      |  A T  A      |  A A  A       At A  A       Ta A  |       Gc G  |       At GC       C  a        t TA       G  a      t  a A  G       Ta       g  t G  |       Cg       a  g GC        Tg        cg TA        At        at TG       C  a       at GC       G  t       tg TA       A  a       ta T  T      C  |       ta T  C      G  |       ta AT       A  |       gc CG        Cg       |  a GC        At        at TA        At        ta TG        At        at AT        At        tg TA        Ta        gc                         tcttttaggtttcgttatgtcagtattaatgttaagataatatccctaaaaaattaaaattaagggaGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [C] COG1390 Archaeal/vacuolar-type H+-ATPase subunit E ... can be seen here [C] COG1527 Archaeal/vacuolar-type H+-ATPase subunit C ... can be seen here [C] COG1436 Archaeal/vacuolar-type H+-ATPase subunit F ... can be seen here [C] COG1155 Archaeal/vacuolar-type H+-ATPase subunit A ... can be seen here [C] COG1156 Archaeal/vacuolar-type H+-ATPase subunit B ... can be seen here [C] COG1394 Archaeal/vacuolar-type H+-ATPase subunit D ... can be seen here     ..................................................................................................................