                                                                        Gene putatively regulated by attenuation in C_tetani_E88

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:101 nt.     Distance to run of Ts=0 nt.   Size=36 nt.     Delta G=-17.50 kcal/mol
Antiterminator: Size=50 nt.     Delta G= -8.80 kcal/mol
Anti-antiterminator:   Size=28 nt.     Delta G= -3.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGGATTCCGATTTATTAAAAGGAGTTGTATATTCTAAAAATAATTGGGCAACTACTCA
ATCTATAGTTATGAGATCTAAAACTGGAACAATAAGATTTGTAGATGCCCAACATCAC
CTATCAAGAAGTAATTTAGTATTATAAttaatagtgaataattgaggtagatttccttttttattaggaaatttaccttt
ttttcatcacattacataaattttcttaataaaattatacatatttatataatatatattataatatatatgttaagtctacagataggaaaaagtaatg
gaggTTG

    CTC01009 --- CTC01010 --- CTC01011 Gene: CTC01009     GI: 28210714     BI number: CTC01009     GOG: COG0860     Description: conserved protein, putative N-acetylmuramoyl-L-alanine amidase Gene: CTC01010     GI: 28210715     BI number: CTC01010     GOG: COG1493     Description: serine kinase Gene: CTC01011     GI: 28210716     BI number: CTC01011     GOG: COG0212     Description: 5-formyltetrahydrofolate cyclo-ligas            AA           T  t            At            Ta            Ta            At            Ta           G  g            At        tt            Tg       t  a            Ta       t  t   C        Ta       t  t C  A       At        ta C  A      A  a       cg GC        Ta        cg TA        Gt        ta AT        At        ta GC       A  g       ta A  |      G  a       at TA       A  |       gt GC       A  |       at T  C       Cg        ta T  T       Tg        gc TA        At        gc AT        Ta        at GC        Cg        gt                         tttttcatcacattacataaattttcttaataaaattatacatatttatataatatatattataatatatatgttaagtctacagataggaaaaagtaatggaggTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [M] COG0860 N-acetylmuramoyl-L-alanine amidase ... can be seen here [T] COG1493 Serine kinase of the HPr protein, regulates carbohydrate metabolism ... can be seen here [H] COG0212 5-formyltetrahydrofolate cyclo-ligase ... can be seen here     ..................................................................................................................