                                                                        Gene putatively regulated by attenuation in C_tetani_E88

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:65 nt.    Distance to gene:57 nt.     Distance to run of Ts=1 nt.   Size=26 nt.     Delta G= -6.80 kcal/mol
Antiterminator:    Distance from promoter:29 nt. Size=39 nt.     Delta G= -3.40 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTCCTC-TATCAT. It has a score value of 60.24 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTCCTCTGCATCTAATCCTTCTATATCATAGACATTAACTATTTTTAATTTTGAAATT
CCTTCTATACCTAAAGTAAGTTTTAAATCCTGTTGAAGGTTTGATGATTCTACGTCAA
ATTTATCTTTTTTTTCTACATAAAGCCTAAATATATTTTTTTTCATagagttttatcccccttaac
gaatattATG

    CTC01028 Gene: CTC01028     GI: 28210733     BI number: CTC01028     GOG: COG1368     Description: alkaline phosphatase superfamily enzym AA T  G GT AT AT AT TA |  A |  A       TC |  T      T  T C  C      A  A C  C       GC AT        TG TG        AT AT        GC T  T       TA CG        TA TA        TA TA        GT CG        GT CG        AT             ATCTTTTTTTTCTACATAAAGCCTAAATATATTTTTTTTCATagagttttatcccccttaacgaatattATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [M] COG1368 Phosphoglycerol transferase and related proteins, alkaline phosphatase superfamily ... can be seen here     ..................................................................................................................