                                                                        Gene putatively regulated by attenuation in C_tetani_E88

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:22 nt.     Distance to run of Ts=0 nt.   Size=24 nt.     Delta G=-12.70 kcal/mol
Antiterminator: Size=70 nt.     Delta G=-10.61 kcal/mol
Anti-antiterminator:   Size=52 nt.     Delta G=-17.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTCTTCAAGTATGGCAACTGAGTTAATAAAAGGGAAGACTTTAGAAGAAGCTTGGGAA
TTATCTAATAAGGCAGTAGCTGATGCATTAGATGGATTACCACCAGTAAAAATGCACT
GCTCAGTATTAGCAGAAGAAGCTATCCATAAGGCTATAAATGATTATAGGGAGTCTAT
AGGTTTAGAGCCTTGGGAAATGAAAGTTCACTCGGATCATATACATGATGAAGTGCAC
GGATGAttatattaaaaatcccaatgaaatatttcattgggatttttaaagaaatactataataaggtATG

    CTC01052 Gene: CTC01052     GI: 28210754     BI number: CTC01052     GOG: COG0482     Description: tRNA (5-methylaminomethyl-2-thiouridylate)-methyltransferas            TA           A  C            TA            AT            CG            TA            AT           G  G           G  A           C  |            TA            CG            AT   A        CG G  G      T  C G  T       TA GC        GC AT       |  G TA       |  G AT       |  A TA       |  T TG       |  G A  |      |  A G  |      |  t TG       |  t AT       |  a AT       |  t AT       |  a TA       A  t A  G      A  t       ta TA       A  a      a  t CG       G  a       at GC       T  a       at GC       A  a       gc AT       A  a       ta AT        At        at TG        Gc        at A  |       Gc        cg CG        Gc        cg CG        Ta        cg TA        Ta        ta                         tttttaaagaaatactataataaggtATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [J] COG0482 Predicted tRNA(5-methylaminomethyl-2-thiouridylate) methyltransferase, contains the PP-loop ATPase domain ... can be seen here     ..................................................................................................................