                                                                        Gene putatively regulated by attenuation in C_tetani_E88

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:164 nt.    Distance to gene:45 nt.     Distance to run of Ts=1 nt.   Size=25 nt.     Delta G= -9.70 kcal/mol
Antiterminator:    Distance from promoter:136 nt. Size=36 nt.     Delta G= -5.90 kcal/mol
Anti-antiterminator:    Distance from promoter:85 nt.    Size=54 nt.     Delta G=-14.30 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGAAA-TAAAAT. It has a score value of 64.93 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGAAAGAAAAAATAAAGTTAGAAGCTAAAATAAGATATTCAGCAAAAGGAGAAATAG
CAGAAATAGAACCTTTAGAAAATAATAGGGTAAAAGTTACCTTTGATAAAAAGCAAAG
GGCTATAACAAAAGGGCAGTCGGTAGTATTTTATATTGAAAACCTTTTGCTTGGTGGA
GGAATAATAGAATCAGTTGAAAGCTCTACTTAAtttaaaagtagagtatattttttgtttcgtaagtaaaaaatat
ataaaagcatatatttgaaggtgattttGTG

    CTC01053 --- CTC01054 Gene: CTC01053     GI: 28210755     BI number: CTC01053     GOG: COG3881     Description: conserved protein Gene: CTC01054     GI: 28210756     BI number: CTC01054     GOG: COG0628     Description: permeas TT A  T T  T G  A AT TA GT GT CG TA         A G  A      A  T A  A      G  C C  A      A  A G  |       TG GC        AT GC        AT         t AT        TG       t  t AT       |  A      A  a AT       A  A      A  a AT       A  A       Ta CG       G  G       Ta A  C       GC        Cg A  T       AT        At T  |       GC        Ta AT        GT        Cg TG        TA        Ta CG        GC        Cg GT        GT        Gt                         atattttttgtttcgtaagtaaaaaatatataaaagcatatatttgaaggtgattttGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG3881 Uncharacterized protein conserved in bacteria ... can be seen here [R] COG0628 Predicted permease ... can be seen here     ..................................................................................................................