                                                                        Gene putatively regulated by attenuation in C_tetani_E88

This operon is putativelly rgulated by Aminoacyl-tRNA-synthetase_T-box

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:172 nt.    Distance to gene:36 nt.     Distance to run of Ts=0 nt.   Size=34 nt.     Delta G= -9.84 kcal/mol
Antiterminator:    Distance from promoter:157 nt. Size=29 nt.     Delta G= -9.80 kcal/mol
Anti-antiterminator:    Distance from promoter:120 nt.    Size=46 nt.     Delta G= -7.40 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgaca-tataat. It has a score value of 98.39 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case
The T-box sequence: agggtggtaccgcg is shown in italic-bold style

ttgacatattatgattttttatttataatcgttatcaaaatgaataattatgacaatgataaaaaggagtaaatatttaattattataaagagaggaagt
ggaaggtgaaaacttcttaataattgtattgaagctatttttgagtctttagaactttaagagatacaattttatattgtataaatagggtggtaccgcggaagctttcgtcccttatagataaaacgaaggcttttttgtcgtttgattgtaaaaagattaggaggaaataaatATG

    CTC01055 Gene: CTC01055     GI: 28210757     BI number: CTC01055     GOG: COG0013     Description: alanyl-tRNA synthetas   t t  a t  t ta at at cg at                  ta ta        ga       a  g at       g  a      t  a g  a       cg       t  t a  a       gc       c  a g  a      c  t      c  a a  |      c  t      c  a at       a  |       ta ta       t  |       gc tg        gt        cg tg        gc        ta cg        tg        ta at       |  t       tg a  g       gc        cg g  g       gc        gc at        gc        at ta        at        at                         ttttgtcgtttgattgtaaaaagattaggaggaaataaatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [J] COG0013 Alanyl-tRNA synthetase ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Aminoacyl-tRNA-synthetase_T-box sequence ... can be seen here     ..................................................................................................................