                                                                        Gene putatively regulated by attenuation in C_tetani_E88

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:47 nt.    Distance to gene:46 nt.     Distance to run of Ts=0 nt.   Size=25 nt.     Delta G=-14.70 kcal/mol
Antiterminator:    Distance from promoter:19 nt. Size=31 nt.     Delta G= -4.20 kcal/mol
Anti-antiterminator:   Size=53 nt.     Delta G= -3.50 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGATG-TACATT. It has a score value of 67.6 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGATGTTGTATATGCAAGTAATACATTATTACAAGTACATGTGAAGTTTAATGGTGA
TATAAAAATCAATTATTGAgtagccgatttattcggttgctcttttctttaaaagatagattctaaataagattttatagaaagga
atgatagcATG

    CTC01110 Gene: CTC01110     GI: 28210809     BI number: CTC01110     GOG: -------     Description: conserved protei TA G  C A  A AT CG AT TG TA |  A |  G |  T |  T AT TA TA AT CG        AA A  G      T  A T  |      A  A A  |       TA         t A  |       AT       t  a T  |       GC       t  t G  |      |  A       at A  |       TA        gc AT        GT        cg CG        GT        cg G  |       TA        gt TA        AT        at AT        AT        tg TA        TG        gc AT        TA        At TA        Tg        Gc                         ttttctttaaaagatagattctaaataagattttatagaaaggaatgatagcATG     ..................................................................................................................