                                                                        Gene putatively regulated by attenuation in C_tetani_E88

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:80 nt.    Distance to gene:133 nt.     Distance to run of Ts=0 nt.   Size=24 nt.     Delta G=-10.90 kcal/mol
Antiterminator:    Distance from promoter:34 nt. Size=55 nt.     Delta G= -8.90 kcal/mol
Anti-antiterminator:    Distance from promoter:4 nt.    Size=50 nt.     Delta G= -9.10 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TGGATA-TATAAA. It has a score value of 61.58 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TGGATATGGCTTTAGCAGAATTATATAAAAAAGAATTGATATCTTATGATAAGGCAAT
AGCCTACTCTACAGATAGGGAAATTATTAAAAAAATGATATCCATATAAaaaataggagtatta
atactcctattttttatatatgtaataaatggtgtataatatatataggataaattcataaaaattcatcagaatgcaaataatttaaaataatatagta
attatgttttaattatgataaaataaccatgaattaggggggataattTTG

    CTC01120 Gene: CTC01120     GI: 28210817     BI number: CTC01120     GOG: COG1215     Description: N-acetylglucosaminyltransferas             A           A  A           A  A            TA AT        TA A  A       AT CG        TG GC        TA GC        AT AT       A  A A  A       AT T  C       GC AT        GC GC       G  A T  T       AT A  A       TA T  C       AT TA       |  A CG       |  A       ta TA       |  a      t  a AT       |  a       at TA       G  a       ta |  G      A  a       gc |  G      C  t       at A  G      A  a       gc G  A       Tg        gc TA        Cg        at TA        Ta        ta AT        Cg        at AT        At        at                         ttttatatatgtaataaatggtgtataatatatataggataaattcataaaaattcatcagaatgcaaataatttaaaataatatagtaattatgttttaattatgataaaataaccatgaattaggggggataattTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [M] COG1215 Glycosyltransferases, probably involved in cell wall biogenesis ... can be seen here     ..................................................................................................................