Gene putatively regulated by attenuation in C_tetani_E88

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:72 nt.     Distance to run of Ts=0 nt.   Size=40 nt.     Delta G=-21.10 kcal/mol
Antiterminator: Size=68 nt.     Delta G= -4.71 kcal/mol
Anti-antiterminator:   Size=79 nt.     Delta G= -6.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GCATGGTGGTAGAAGGTATAAAAGCTTGTAAAGCCTTTTATGAATTAAAGGAAAAGTT
AAAAGTATCTATGCCCATAACGGATGCTTTATATAGAGTTCTATTTCAAGGGGAAGAT
GCTAAATACTGTGTATATGAATTGATGACTAGAGACAAAAAAGATGAATAAatttaatctta
tattttaaagtaatctgtagaaattaaaatttctacagattactttttttatatgtaatatttaagggggaagcaaaatatatatatactgttaatatta
gtttataggagggtaagtaaacTTG

    CTC01140


Gene: CTC01140     GI: 28210833     BI number: CTC01140     GOG: NOG05030     Description: stage IV sporulation protein


 AT
A  A
A  C
T  T        A
 CG       A  a
 GT       T  t
 TG       A  t
 AT       A  t
G  A      G  a
A  T       Ta
A  A       At
G  T       Gc
G  G       At
G  A       At
G  A      |  a
 AT       |  t
 AT       |  a
 CG       |  t
 TA       |  t
|  T      |  t
|  G      |  t
T  A      |  a
T  C      |  a       aa
 AT       A  a      t  a
 TA       A  g       ta
 CG       A  t       at
 TA       A  a       at
 TG       C  a       at
|  A       At        gc
|  C       Gc        at
|  A       At        ta
G  A      G  g       gc
A  A       At        ta
G  A       Ta        cg
A  A       Cg        ta
T  A      A  a       at
A  G      G  a       at
 TA        Ta        ta
 AT        At        gc
 TG        Gt        at
 TA        Ta        at
 TA        Ta        at
                        ttttatatgtaatatttaagggggaagcaaaatatatatatactgttaatattagtttataggagggtaagtaaacTTG


    ..................................................................................................................