                                                                        Gene putatively regulated by attenuation in C_tetani_E88

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:96 nt.     Distance to run of Ts=1 nt.   Size=27 nt.     Delta G=-16.30 kcal/mol
Antiterminator: Size=65 nt.     Delta G= -3.97 kcal/mol
Anti-antiterminator:   Size=69 nt.     Delta G= -6.14 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

gcaaaagatagtcaacctgataataaaaaagcaagaatggagaagtgtaactatcagattcctataactagtgaggaaggaaaaaatcaaaatagaacgc
taaaaaaacattctgtaaagagaaaaggctttcaaagtcagcatataaattagaaggataaagagtaaaagggacagttaattgctagctgtccctaatt
tttatgttgataattatttaaggttataaaatttaatggtataattatggtaaattatttgttatttataaaaatagatatgtaaataaggagaaacatt
ATG

    CTC01157 Gene: CTC01157     GI: 28210850     BI number: CTC01157     GOG: COG1408,COG3326     Description: phosphoesteras   a a  a        a a  a      a  a t  a      t  t c  a       at g  c       ta c  a      a  g at       c  a at       g  a gc       a  g at        cg tg        ta at        gt a  a      a  a a  a      a  a a  a      a  | cg       c  | ta        ta |  g       tg a  a       ta a  a       cg a  a       gt a  a      g  a a  g      a  a        t a  g      a  a      t  g gc       a  a      a  c gt       a  g       at at       g  g       ta at       a  g       tg gc       g  |       gc |  a      a  |       at |  a      a  |       cg |  a      a  |       at g  g       ta        gc at        gc        gc gc        ta        gc ta        cg        at                         aatttttatgttgataattatttaaggttataaaatttaatggtataattatggtaaattatttgttatttataaaaatagatatgtaaataaggagaaacattATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG1408 Predicted phosphohydrolases ... can be seen here [S] COG3326 Predicted membrane protein ... can be seen here     ..................................................................................................................